Journal of Veterinary Research

Journal of Veterinary Research

Morphometric and Molecular Analysis of Gyrodactlus kobayashi in Carassius auratus (Linnaeus, 1758)

Authors
1 Department of Marine Biology, Faculty of Marine Sciences, University of Mazandaran, Babolsar-Iran
2 Department of Aquatic Animal Health, Faculty of Veterinary Medicine, University of Tehran, Tehran-Iran
3 Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, Tehran-Iran
4 Department of Animal and Poultry Health and Nutrition, Faculty of Veterinary Medicine, University of Tehran, Tehran-Iran
Abstract
BACKGROUND: Fish are constantly exposed to various pathogens and parasites in particular. Gyrodactylus from Platyhelminthes is an important monogenean ectoparasite that can cause disease and economical losses to cultured, wild, salt and fresh water and ornamental fish. Gyrodactylus appears to be one of the most prevalent parasites of ornamental fish especially in Cyprinids. Objectives: The present study aimed to identify morphometric and molecular characteristics of Gyrodactylus parasite on Carassius auratus (Linnaeus, 1758). Methods: Gyrocactylus parasites were isolated from skin, fins and gills of the fish with wet mount slide and were examined under light microscopy. The morphometrical characterization of Gyrodactylus specimens was performed using the measurements and drawings of opisthaptoral hard parts of the parasites. The molecular species description was based on polymerase chain reaction (PCR) of partial sequence of 5.8S region of ribosomal RNA (5´CGATCATCGGTCTCTCGAAC3´) and partial sequence of internal transcribed spacer2 (ITS2) of ribosomal RNA (5´TTAAGGAAGAACCACTAGAG3´). ResultS: Gyrodactylus species morphology identification was performed using Yamaguti (1961) identification key. The nucleotide sequences of the PCR products were compared with GenBank sequences. Conclusions: Based on morphometric analysis and sequencing, the Gyrodactylus specimens were described as Gyrodactylus kobayashi. Combination of molecular techniques with morphological analysis seems to be the best approach to identification of Gyrodactylus spices.
Keywords

Bakke, T.A., Harris, P.D., Cable, J. (2002) Host specificity dynamics: observations on gyrodactylid monogeneans. Int J Parasitol. 32: 281–308.
Bakke, T.A., Cable, J., Harris, P.D. (2007) The biology of Gyrodactylid monogeneans: the “russian doll-killers”. Adv Parasitol. 64: 161-376.
Collins, C.M., Buchmann, K., Cunningham, C.O. (2002) Diagnosis of Gyrodactylus (Monogenea; Platyhelminthes) infecting salmonid fish in Northern europe. Fish Res Serv. 72: 2-54.
Cunningham, C.O., McGillivray, D.M., MacKenzie, K., Melvin, W.T. (1995) Discrimination between Gyrodactylus salaris, G. derjavini, and G. truttae (Platyhelminthes: Monogenea) using restriction fragment length polymorphisms and an oligonucleotide probe within the small subunit ribosomal RNA gene. Parasitology. 111: 87-94.
Ebrahimzadeh Mousavi, H.A. (2003) Parasites of ornamental fish in Iran. Bull Eur Assoc Fish Pathol. 23: 297-300.
Ebrahimzadeh Mousavi, H.A., Mehdizadeh, S., Shoeibi, B., Mokhayer, B., Soltani, M., Ahmadi, M., Mirzargar, S. (2009) Gill ectoparasites of goldfish imported into Iran. Bull Eur Assoc Fish Pathol. 29: 69-74.
Ergens, R., Yukhimenko, S.S. (1987) Contribution to the knowledge of Gyrodactylus gurleyi Price 1937 (monogenea: Gyrodactylidae). Folia Parasitol. 34: 205-209.
García-Vásquez, A.,  Razo-Mendivil, U., Rubio-Godoy, M. (2015) Morphological and molecular description of eight new species of Gyrodactylus von Nordmann, 1832 (Platyhelminthes: Monogenea) from poeciliid fishes, collected in their natural distribution range in the Gulf of Mexico slope, Mexico. Parasitol Res. 114: 3337-55.
Gussev, A.V. (1985) Monogenea. In: Key to Parasites of Freshwater Fishes of USSR. Bauer, O.N. (ed.). Vol 2, Nauka Leningrad, USSR. p. 424- 430.
Hansen, H., Bakke, T.A., Bachmann, L. (2007) DNA taxonomy and barcoding of monogenean parasites: lessons from Gyrodactylus. Trend Parasitol. 23: 363-367.
Harris, P.D., Shinn, A.P., Cable, J., Bakke, T.A. (2004) Nominal species of the genus Gyrodactylus von Nordmann 1832 (Monogenea: Gyrodactylidae), with a list of principal host species. Syst Parasitol. 59: 1-27.
Huyse, T., Malmberg, G., Volckaert, A.M. (2004) Four new species of Gyrodactylus von Nordmann, 1832 (Monogenea, Gyrodactylidae) on gobiid fishes: combined DNA and morphological analyses. Syst Parasitol. 59: 103-120.
Jalali, B., Shamsi, Sh., Barzegar, M. (2005) Occurance of Gyrodactylus spp (monogenea: gyrodactylidae) from Iranian freshwater. Iran J Fish Sci. 4: 19-30.
Jalali, B., Miar, A., Bozorgnia, A., Pazooki, J., Barzegar, M.,  Masoumian, M. (2008) Fish parasite in Valasht Lake and Chalus River. Iran Sci Fish J.17: 133-138.
Malmberg, G., Collins, C.M., Cunningham, C.O., Jalali, B. (2007) Gyrodactylus derjavinoides sp. nov. (Monogenea, Platyhelminthes) on Salmo trutta trutta L. and G. derjavini Mikailov, 1975 on S. t. caspius Kessler, two different species of Gyrodactylus – combined morphological and molecular investigations. Acta Parasitol. 52: 89-103.
Matejusova, I., Gelnar, M., McBeath, A.J.A. (2001) Molecular markers for gyrodactylids (Gyrodactylidae: Monogenea) from five families (Teleostei). Int J Parasitol. 31: 738-745.
Noga, E.J. (2010) Fish Disease: Diagnosis and Treatment. (2nd ed) Wiley-Blackwell, Iowa, USA.
Paladini, G., Huyse, T., Shinn, A.P. (2011) Gyrodactylus salinae, n. sp. (Platyhelminthes: Monogenea) infecting the south European toothcarp Aphanius fasciatus (Valenciennes) (Teleostei, Cyprinodontidae) from a hyper saline environment in Italy. Parasit Vect. 4: 100 -112.
Pazooki, J., Mansouri-Habibabadi, Z., Masoumian, M., Aghaee-Moghadam, A. (2011) Survey on the metazoan parasites in Neogobius fishes from Southeastern part of the Caspian Sea. Iran J Fish Sci. 10: 95-104.
Pazooki, J., Masoumian, M., Yahyazadeh, M. Sadri, G.,  Jalali, B. (2004) Monogenean parasites from fresh water fishes of Northwest Iran. Pajouhesh & Sazandegi. (In Persian). 77: 17-25.
Rasouli, S., Nekuifard, A., Azadikhah, D., Ahari, H., Anvar, A.A., Khodadadi, A., Ghasemi, A. (2012) Ectoparasite infection of Carassius carassius in water resources of west Azerbaijan. Iran  J Fish Sci. 11: 156-164.
Rokicka, M., Lumme, J., Ziêtara, M.S. (2007) Identification of Gyrodactylus ectoparasites in Polish salmonid farms by PCR-RFLP of the nuclear ITS segment of ribosomal DNA (Monogenea, Gyrodactylidae). Acta Parasitol. 52: 185-195.
Thilakaratne, I.D., Rajapaksha, G., Hewakopara, A. (2003) Parasitic infections in freshwater ornamental fish in Sri Lanka. Dis Aquat Org. 54: 157-162.
Yamaguti, S. (1961) Systema Helminthum:  Monogenea and Aspidocotrlea. (1st ed.) John Wiley & Sons, London, UK.
You, P., Guo, Z., King, S.D., Cone, D.K. (2010) A new gyrodactylid species from Cobitis granoei (Rendahl) (Cobitidae) in central China. J Parasitol. 96: 897-899.