بررسی مورفومتریک و مولکولی انگل ژیروداکتیلوس کوبایاشی در ماهی طلایی (Linnaeus, 1758)رCarassius auratus

نویسندگان

1 گروه زیست شناسی دریا، دانشکده علوم دریایی دانشگاه مازندران، بابلسر- ایران

2 گروه بهداشت و بیماریهای آبزیان، دانشکده دامپزشکی دانشگاه تهران، تهران- ایران

3 گروه انگل شناسی، دانشکده دامپزشکی دانشگاه تهران، تهران- ایران

4 گروه بهداشت و تغذیه دام وطیور، دانشکده دامپزشکی دانشگاه تهران، تهران- ایران

چکیده

زمینه مطالعه: ماهیها همواره در معرض عوامل بیماریزای مختلف هستند که در این میان انگلها نقش مهمی دارند. انگل ژبروداکتیلوس از شاخه کرمهای پهن و از جمله انگلهای خارجی تک میزبانه مهم ماهیهای پرورشی و آزاد آبهای شیرین، شور و ماهیهای زینتی محسوب میشود که میتواند سبب ایجاد بیماری و خسارات اقتصادی قابل توجهی گردد. انگل ژیروداکتیلوس در بین ماهیهای زینتی به ویژه در خانواده کپورماهیان بسیار شایع است. هدف: در این مطالعه انگل ژیروداکتیلوس بر اساس ویژگیهای مورفومتریک و مولکولی در ماهی طلایی مورد بررسی قرار گرفت. روش کار: انگل ژیروداکتیلوس از سطح بدن، پوست، بالهها و آبشش نمونههای ماهی طلایی پس از انتقال به آزمایشگاه توسط گسترش مرطوب جداسازی گردید و توسط میکروسکوپ نوری مورد بررسی قرار گرفت. ویژگیهای ریخت شناسی هریک از انگلها با اندازهگیری قسمتهای مختلف اپیستهاپتور انگل  (قلاب مرکزی، قلابک حاشیهای، میله پشتی و میله شکمی) انجام شد. جهت بررسی مولکولی گونه انگل ژیروداکتیلوس، پرایمر بالادست، در ناحیه 8/5 ژن RNA ریبوزومی ('3'CGATCATCGGTCTCTCGAAC'5) و پرایمر پایین دست، در ناحیه ITS2 ژن RNA ریبوزومی ('3'TTAAGGAAGAACCACTAGAG'5) برای تکثیر DNA گونههای انگل ژیروداکتیلوس به روش PCR، طراحی گردید. نتایج: ویژگیهای ریختی گونه انگل ژیروداکتیلوس با استفاده از کلیدهای تشخیصی Yamaguti در سال1961 بررسی گردید، سپس توالی  به دست آمده از انگل مورد نظر با توالیهای ثبت شده انگل ژیروداکتیلوس در ژن بانک مورد مقایسه قرار گرفت و نهایتاً انگل ژیروداکتیلوس کوبایاشی شناسایی گردید. نتیجه گیری نهایی: استفاده از نتایج بررسی مورفومتریک همراه با نتایج مولکولی، بهترین روش دستیابی به شناسایی صحیح گونههای جدید این انگل میباشد.

کلیدواژه‌ها


عنوان مقاله [English]

Morphometric and Molecular Analysis of Gyrodactlus kobayashi in Carassius auratus (Linnaeus, 1758)

نویسندگان [English]

  • Shila Omidzahir 1
  • Hosseinali Ebrahimzadeh Mousavi 2
  • Parviz Shayan 3
  • Elahe Ebrahimzadeh Abkooh 3
  • Homayoun Mahmoodzadeh 4
1 Department of Marine Biology, Faculty of Marine Sciences, University of Mazandaran, Babolsar-Iran
2 Department of Aquatic Animal Health, Faculty of Veterinary Medicine, University of Tehran, Tehran-Iran
3 Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, Tehran-Iran
4 Department of Animal and Poultry Health and Nutrition, Faculty of Veterinary Medicine, University of Tehran, Tehran-Iran
چکیده [English]

BACKGROUND: Fish are constantly exposed to various pathogens and parasites in particular. Gyrodactylus from Platyhelminthes is an important monogenean ectoparasite that can cause disease and economical losses to cultured, wild, salt and fresh water and ornamental fish. Gyrodactylus appears to be one of the most prevalent parasites of ornamental fish especially in Cyprinids. Objectives: The present study aimed to identify morphometric and molecular characteristics of Gyrodactylus parasite on Carassius auratus (Linnaeus, 1758). Methods: Gyrocactylus parasites were isolated from skin, fins and gills of the fish with wet mount slide and were examined under light microscopy. The morphometrical characterization of Gyrodactylus specimens was performed using the measurements and drawings of opisthaptoral hard parts of the parasites. The molecular species description was based on polymerase chain reaction (PCR) of partial sequence of 5.8S region of ribosomal RNA (5´CGATCATCGGTCTCTCGAAC3´) and partial sequence of internal transcribed spacer2 (ITS2) of ribosomal RNA (5´TTAAGGAAGAACCACTAGAG3´). ResultS: Gyrodactylus species morphology identification was performed using Yamaguti (1961) identification key. The nucleotide sequences of the PCR products were compared with GenBank sequences. Conclusions: Based on morphometric analysis and sequencing, the Gyrodactylus specimens were described as Gyrodactylus kobayashi. Combination of molecular techniques with morphological analysis seems to be the best approach to identification of Gyrodactylus spices.

کلیدواژه‌ها [English]

  • Carassius auratus (Linnaeus
  • 1758)
  • Gyrodactylus kobayashi
  • morphometric and molecular characterization
Bakke, T.A., Harris, P.D., Cable, J. (2002) Host specificity dynamics: observations on gyrodactylid monogeneans. Int J Parasitol. 32: 281–308.

Bakke, T.A., Cable, J., Harris, P.D. (2007) The biology of Gyrodactylid monogeneans: the “russian doll-killers”. Adv Parasitol. 64: 161-376.

Collins, C.M., Buchmann, K., Cunningham, C.O. (2002) Diagnosis of Gyrodactylus (Monogenea; Platyhelminthes) infecting salmonid fish in Northern europe. Fish Res Serv. 72: 2-54.

Cunningham, C.O., McGillivray, D.M., MacKenzie, K., Melvin, W.T. (1995) Discrimination between Gyrodactylus salaris, G. derjavini, and G. truttae (Platyhelminthes: Monogenea) using restriction fragment length polymorphisms and an oligonucleotide probe within the small subunit ribosomal RNA gene. Parasitology. 111: 87-94.

Ebrahimzadeh Mousavi, H.A. (2003) Parasites of ornamental fish in Iran. Bull Eur Assoc Fish Pathol. 23: 297-300.

Ebrahimzadeh Mousavi, H.A., Mehdizadeh, S., Shoeibi, B., Mokhayer, B., Soltani, M., Ahmadi, M., Mirzargar, S. (2009) Gill ectoparasites of goldfish imported into Iran. Bull Eur Assoc Fish Pathol. 29: 69-74.

Ergens, R., Yukhimenko, S.S. (1987) Contribution to the knowledge of Gyrodactylus gurleyi Price 1937 (monogenea: Gyrodactylidae). Folia Parasitol. 34: 205-209.

García-Vásquez, A.,  Razo-Mendivil, U., Rubio-Godoy, M. (2015) Morphological and molecular description of eight new species of Gyrodactylus von Nordmann, 1832 (Platyhelminthes: Monogenea) from poeciliid fishes, collected in their natural distribution range in the Gulf of Mexico slope, Mexico. Parasitol Res. 114: 3337-55.

Gussev, A.V. (1985) Monogenea. In: Key to Parasites of Freshwater Fishes of USSR. Bauer, O.N. (ed.). Vol 2, Nauka Leningrad, USSR. p. 424- 430.

Hansen, H., Bakke, T.A., Bachmann, L. (2007) DNA taxonomy and barcoding of monogenean parasites: lessons from Gyrodactylus. Trend Parasitol. 23: 363-367.

Harris, P.D., Shinn, A.P., Cable, J., Bakke, T.A. (2004) Nominal species of the genus Gyrodactylus von Nordmann 1832 (Monogenea: Gyrodactylidae), with a list of principal host species. Syst Parasitol. 59: 1-27.

Huyse, T., Malmberg, G., Volckaert, A.M. (2004) Four new species of Gyrodactylus von Nordmann, 1832 (Monogenea, Gyrodactylidae) on gobiid fishes: combined DNA and morphological analyses. Syst Parasitol. 59: 103-120.

Jalali, B., Shamsi, Sh., Barzegar, M. (2005) Occurance of Gyrodactylus spp (monogenea: gyrodactylidae) from Iranian freshwater. Iran J Fish Sci. 4: 19-30.

Jalali, B., Miar, A., Bozorgnia, A., Pazooki, J., Barzegar, M.,  Masoumian, M. (2008) Fish parasite in Valasht Lake and Chalus River. Iran Sci Fish J.17: 133-138.

Malmberg, G., Collins, C.M., Cunningham, C.O., Jalali, B. (2007) Gyrodactylus derjavinoides sp. nov. (Monogenea, Platyhelminthes) on Salmo trutta trutta L. and G. derjavini Mikailov, 1975 on S. t. caspius Kessler, two different species of Gyrodactylus – combined morphological and molecular investigations. Acta Parasitol. 52: 89-103.

Matejusova, I., Gelnar, M., McBeath, A.J.A. (2001) Molecular markers for gyrodactylids (Gyrodactylidae: Monogenea) from five families (Teleostei). Int J Parasitol. 31: 738-745.

Noga, E.J. (2010) Fish Disease: Diagnosis and Treatment. (2nd ed) Wiley-Blackwell, Iowa, USA.

Paladini, G., Huyse, T., Shinn, A.P. (2011) Gyrodactylus salinae, n. sp. (Platyhelminthes: Monogenea) infecting the south European toothcarp Aphanius fasciatus (Valenciennes) (Teleostei, Cyprinodontidae) from a hyper saline environment in Italy. Parasit Vect. 4: 100 -112.

Pazooki, J., Mansouri-Habibabadi, Z., Masoumian, M., Aghaee-Moghadam, A. (2011) Survey on the metazoan parasites in Neogobius fishes from Southeastern part of the Caspian Sea. Iran J Fish Sci. 10: 95-104.

Pazooki, J., Masoumian, M., Yahyazadeh, M. Sadri, G.,  Jalali, B. (2004) Monogenean parasites from fresh water fishes of Northwest Iran. Pajouhesh & Sazandegi. (In Persian). 77: 17-25.

Rasouli, S., Nekuifard, A., Azadikhah, D., Ahari, H., Anvar, A.A., Khodadadi, A., Ghasemi, A. (2012) Ectoparasite infection of Carassius carassius in water resources of west Azerbaijan. Iran  J Fish Sci. 11: 156-164.

Rokicka, M., Lumme, J., Ziêtara, M.S. (2007) Identification of Gyrodactylus ectoparasites in Polish salmonid farms by PCR-RFLP of the nuclear ITS segment of ribosomal DNA (Monogenea, Gyrodactylidae). Acta Parasitol. 52: 185-195.

Thilakaratne, I.D., Rajapaksha, G., Hewakopara, A. (2003) Parasitic infections in freshwater ornamental fish in Sri Lanka. Dis Aquat Org. 54: 157-162.

Yamaguti, S. (1961) Systema Helminthum:  Monogenea and Aspidocotrlea. (1st ed.) John Wiley & Sons, London, UK.

You, P., Guo, Z., King, S.D., Cone, D.K. (2010) A new gyrodactylid species from Cobitis granoei (Rendahl) (Cobitidae) in central China. J Parasitol. 96: 897-899.