بررسی بیماری کلیه پلی‌کیستیک در گربه‌های ایرانی ارجاعی به بیمارستان دام‌های کوچک دانشکده دامپزشکی دانشگاه تهران به دو روش سونوگرافی و مولکولی

نوع مقاله : بهداشت و بیماری های دام های کوچک

نویسندگان

1 گروه بیماری‌های داخلی، دانشکده دامپزشکی دانشگاه تهران، تهران، ایران

2 گروه جراحی و رادیولوژی، دانشکده دامپزشکی دانشگاه تهران، تهران، ایران

3 گروه میکروبیولوژی و ایمونولوژی، دانشکده دامپزشکی دانشگاه تهران، تهران، ایران

4 گروه بهداشت و مواد غذایی، دانشکده دامپزشکی دانشگاه تهران، تهران، ایران

چکیده

زمینۀ مطالعه: بیماری کلیه پلی‌کیستیک شایع‌ترین بیماری ژنتیکی در گربه‌های پرشین می‌باشد که به‌دنبال موتاسیون در ژن‌های PKD1 و PKD2 ایجاد می‌شود. در این بیماری به‌دلیل تجمع مایعات در داخل کیست‌ها و فشار حاصل از آن‌ها بر‌روی بافت کلیه، بیمار مستعد ایجاد علائم نارسایی کلیوی مزمن خواهد‌ شد.
هدف: مطالعه حاضر با هدف مقایسه دو روش اولتراسونوگرافی و آزمایش مولکولی در تشخیص بیماران مبتلا به کلیه پلی‌کیستیک اتوزومال انجام ‌شد.
روشکار: مطالعه حاضر بر روی 97‌ قلاده گربه نژاد پرشین (46‌ قلاده گربه نر و 51‌ قلاده گربه ماده) با میانگین 6‌ سال (حداقل 2‌ ماه و حداکثر 14‌ سال) انجام شد.
نتایج: از 97‌ قلاده گربه پرشین مورد بررسی در 32‌ مورد (33 درصد) با روش اولتراسونوگرافی کیست‌های بدون اکوژنیسیته در کلیه وجود داشت. در آزمایش مولکولی تمام موارد دارای کیست در روش اولتراسونوگرافی، دارای جهش در ژن PKD1 بودند و همچنین 13 مورد (13 درصد) که در اولتراسونوگرافی فاقد کیست بودند با روش مولکولی مثبت تشخیص داده شدند. از 97 قلاده گربه تحت بررسی 45­ مورد (46 درصد) حاوی ژن جهش‌یافته بودند. درجه توافق دو روش تشخیصی اولتراسونوگرافی و PCR با محاسبه کاپا 725/0 (859/0- 592/0Cl:) تعیین ‌شد. میزان حساسیت و ویژگی روش اولتراسونوگرافی به ترتیب 11/77 و 100 درصد محاسبه ‌‌شد.
نتیجه­گیری نهایی: جهت تشخیص این بیماری از روش‌های تصویربرداری و مولکولی استفاده می‌شود. افزایش تشخیص موارد بیماری با روش مولکولی نسبت به سونوگرافی می‌تواند به‌دلیل حساسیت بالا‌تر روش مولکولی، کوچک ‌بودن اندازه کیست‌ها، کم ‌بودن تعداد آن‌ها در برخی موارد، پایین ‌بودن سن حیوان و همچنین وجود کیست در مدولای کلیه باشد. بنابراین روش مولکولی در غربالگری بیماری در مراحل اولیه و در برنامه‌های پرورشی و حذف گربه‌های حاوی این ژن می‌تواند مورد استفاده قرار داده ‌شود.

کلیدواژه‌ها


عنوان مقاله [English]

Evaluation of Polycystic Kidney Disease in Iranian Cats Referred to the Small Animal Hospital of the Faculty of Veterinary Medicine, University of Tehran, via Ultrasound and Molecular Methods

نویسندگان [English]

  • Farnaz Abdali Dehdezi 1
  • Shahram Jamshidi 1
  • Mahsa Zangisheh 2
  • Iraj Ashrafi Tamai 3
  • Majid Masoudifard 2
  • Ali Moazezi Ghavi Helm 1
  • Hamideh Hasannejad 4
1 Department of Internal Medicine, Faculty of Veterinary Medicine, Tehran University, Tehran, Iran
2 Department of Surgery and Radiology, Faculty of Veterinary Medicine, Tehran University, Tehran, Iran
3 Department of Microbiology and Immunology, Faculty of Veterinary Medicine, Tehran University, Tehran, Iran
4 Department of Food Hygiene and Quality Control, Faculty of Veterinary Medicine University, Tehran, Iran
چکیده [English]

BACKGROUND: Polycystic kidney disease is the most prevalent inherited genetic disease in Persian cats, which is caused by mutations in PKD1 and PKD2 genes. Due to the accumulation of fluids inside the cysts and their pressure on the renal parenchym, the patient is prone to developing symptoms of chronic renal failure.OBJECTIVES: The present study aimed to compare ultrasonography and molecular tests in diagnosis of autosomal dominant polycystic kidney disease.METHODS: This study was performed on 97 Persian cats, including 46 male and 51 female cats, with an average age of 6 years (minimum 2 months and maximum 14 years). All the cats were evaluated for the presence of disease using ultrasound and molecular methods.
RESULTS: Among 97 females, 32 (33 %) were found to be positive for PKD on the basis of presence of anechoic cysts. In molecular tests, all the cases with cysts in the ultrasonography had mutation in PKD1 gene and 13 cases (13 %) without cysts in ultrasonography were diagnosed to be positive through molecular technique. Among 97 studied cats, 45 (46 %) showed mutated genes. The degree of agreement between the two methods of ultrasonography and PCR was determined by calculating Kapa 0.725 (Cl: 0.592-0.895). The sensitivity and specificity of the ultrasonography were calculated to be 77.11 % and 100 %, respectively.
CONCLUSIONS: Imaging and molecular methods were utilized to diagnose the disease. The more frequent use of the molecular methods for the diagnosis of the disease compared to the use of ultrasound could be attributed to the higher sensitivity of the molecular technique, the small size of the cysts, the low number of cysts, the low age of the animal, and the presence of cysts in the medula of the kidney. Therefore, the molecular method could be recommended for screening the disease in the early stages. It can also be employed in breeding programs and the removal of cats with this mutated gene.

کلیدواژه‌ها [English]

  • persian cats
  • Autosomal dominant polycystic kidney disease
  • Inheritance disease
  • Ultrasonography
  • PCR

مقدمه

 

بیماری کلیه پلی‌کیستیک یک بیماری ژنتیکی پیشرونده و غیرقابل ‌بازگشت می‌باشد که در انسان و بسیاری از حیوانات از جمله سگ و گربه از شیوع بالایی برخوردار‌ است (19). این بیماری در گربه‌های نژاد پرشین و مخلوط با پرشین همچون هیمالین، بریتیش مو‌کوتاه و گربه‌های اگزاتیک گزارش‌ شده ‌است (6،12،21). میزان شیوع این بیماری در گربه‌های نژاد پرشین در انگلستان 2/49‌ درصد، در استرالیا 47-45 درصد، در آلمان 3/43‌ درصد و در فرانسه 8/41‌ درصد گزارش ‌شده است (1،2،14،8). در آمریکا تقریباً 500000 نفر و در کل جهان 5/12 میلیون نفر به این بیماری مبتلا هستند (15،26). با توجه به شیوع قابل ‌توجه بیماری در انسان، بررسی بر روی گربه‌های پرشین به‌عنوان مدل می‌تواند ارزشمند باشد (4،5). این بیماری در اثر جهش در دو ژن PKD1 (Polycystic kidney disease1) و PKD2 (Polycystic kidney disease2) ایجاد می‌شود. ژن PKD1 بر روی کروموزوم ­16 و ژن PKD2 بر روی کروموزوم ­4 قرار دارد. 85 درصد موارد بیماری در نتیجه جهش در ژن PKD1 و 15 درصد موارد به دلیل جهش در ژن PKD2 ایجاد می‌شود (19). این جهش باعث تولید ناقص پروتئین‌های پلی‌سیستین 1 و 2 خواهد شد و در نتیجه خواص قطبی سلول‌ها از بین خواهد رفت و سلول‌ها تزاید پیدا می‌کنند و همچنین میزان آپوپتوز و بیان یک فنوتیپ ترشحی نیز افزایش خواهد ‌یافت. پس از تجمع مایعات در فضای داخل کیست‌ها به دلیل ایجاد فشار بر روی نفرون‌ها باعث از بین رفتن آن‌ها و بروز علائم نارسایی کلیوی شامل پر‌ادراری، پر‌نوشی، کاهش مایعات بدن، زخم‌های دهانی، بوی بد دهان، لاغری مفرط، بی‌اشتهایی و استفراغ خواهد ‌شد (12). روش معمول تشخیص بیماری، سونوگرافی می‌باشد. در نمای اولتراسونوگرافی کیست‌های کلیوی به‌صورت ساختارهای بدون اکوژنیسیته، منفرد یا چندتایی و با دیواره‌های مشخص قابل‌ مشاهده خواهند بود (23)، هرچند روش‌های مولکولی می‌توانند در تشخیص مراحل اولیه و تأیید بیماری کمک کنند (24). در حال حاضر هیچ درمان قطعی برای این بیماری وجود ندارد و درمان‌ها صرفاً به‌صورت حمایتی شامل تنظیم اسید و باز و الکترولیت‌ها، محدودیت‌های غذایی به‌منظور کاهش فسفر و پروتئین دریافتی و نیز کنترل فشارخون با استفاده از داروهای بازدارنده آنزیم مبدل آنژیوتانسین انجام می‌شود. مداخلات جراحی شامل آسپیراسیون کیست‌ها و تزریق مواد اسکلروز‌کننده به‌وسیله لاپاراسکوپی به داخل کیست‌ها با نتایج متفاوت مورد استفاده قرار داده ‌شده‌اند. (27). تاکنون در ایران، علیرغم مشاهده موارد بالینی به‌کرات در گربه‌های نژاد پرشین بررسی کاملی بر روی این بیماری انجام ‌نشده‌ است. در مطالعه حاضر از دو روش سونوگرافی و مولکولی به‌صورت هم‌زمان جهت تشخیص موارد بیماری استفاده ‌شد تا با توجه به حساسیت کافی روش مولکولی و سهولت جمع‌آوری نمونه از بزاق بتوان از آن به‌عنوان پایش بیماری در جمعیت گربه‌های نژاد پرشین و حذف موارد بیمار از برنامه‌های پرورشی استفاده ‌شود.

مواد و روش کار

حیوانات مورد مطالعه: در مطالعه حاضر از 97 قلاده گربه نژاد پرشین ارجاعی به بیمارستان دانشکده دامپزشکی دانشگاه تهران با بازه سنی متفاوت (جدول2) در فاصله زمانی بهار 1396 تا تابستان1397 استفاده ‌شد. جمعیت گربه‌های مورد مطالعه شامل 46 قلاده گربه نر و 51 قلاده گربه ماده، با میانگین سنی 6 سال (حداقل 2 ماه و حداکثر 14 سال) بود.

سونوگرافی: با استفاده از دستگاه GE-Velosun 730 Pro انجام ‌شد. برای این منظور پس از کوتاه کردن موهای ناحیه شکم، حیوان بدون استفاده از مقیدکننده شیمیایی به پشت بر روی میز قرار‌ داده ‌شد و با استفاده از پراب 7 مگاهرتز ناحیه کلیه و ساختارهای دیگر محوطه شکمی مورد معاینه قرار گرفت. کیست‌ها ساختارهای بدون اکوژنسیته بودند که در اطراف توسط دیواره نازکی احاطه می‌شدند. همچنین سایر ساختارهای محوطه شکمی از نظر حضور کیست در آن‌ها مورد بررسی قرار داده شد. در صورت حضور و تأیید کیست، تعداد آن‌ها شمارش و برمبنای آن بیماران در 4 گروه، طبق جدول 1 تقسیم‌بندی شدند.

روش مولکولی: به‌منظور انجام آزمایش مولکولی نمونه‌برداری با استفاده از سوآب استریل از ناحیه دهان انجام‌ شد. سواب‌ها درون میکروتیوب استریل به همراه 1 سی‌سی سرم فیزیولوژی 9/0 درصد قرار ‌داده‌ شدند و تا زمان انجام آزمایش درون فریزر 20- ‌درجه سانتی‌گراد نگهداری شدند. آزمایش مولکولی در آزمایشگاه رفرانس مولکولی دانشکده دامپزشکی دانشگاه تهران انجام ‌شد. استخراج DNA توسط کیت استخراج DNA (MBST Iran) طبق پروتکل شرکت سازنده انجام‌ شد و DNA استخراجی در دمای 20- درجه سانتی‌گراد تا زمان انجام آزمون نگهداری‌ شد. در مطالعه حاضر از توالی الیگونوکلئوتیدی پرایمرهای PKD1 استفاده ‌شد. توالی پرایمرهای مورد ‌استفاده به شرح زیر بود:

 AGAGGCAGACGAGGAGCACT PKD F3: و GCCTCGTGGAGAAGGAGGT PKD R2: جهت آزمون PCR، 5/12 میکرولیتر از محلول آماده کار (مسترمیکس 2X شرکت BIONEER کشور کره، 106S- CSTMK.CAT No)، 1 میکرولیتر از هر پرایمر F و R (با غلظت 10 پیکومول در میکرولیتر)، 3 میکرولیتر از DNA استفاده ‌گردید و حجم نهایی با آب مقطر به 25 میکرولیتر رسید. واکنش PCR در دستگاه ترموسیکلر (Techne,TC 512) در 36 سیکل با واسرشت اولیه 94 درجه سانتی‌گراد 5 دقیقه، با تکرار سه مرحله واسرشت 94 درجه 60 ثانیه، مرحله اتصال 55 درجه 60 ثانیه و مرحله همانندسازی 72 درجه 60 ثانیه انجام پذیرفت و در انتها 72 درجه به مدت 5 دقیقه سیکل انتهایی همانندسازی خاتمه ‌یافت. 5 میکرولیتر از محصول PCR در ژل آگارز 5/1 درصد با بافر TBE (1X) الکتروفورز با ولتاژ 100 به مدت 1 ساعت الکتروفورز گردید و پس از رنگ‌آمیزی با اتیدیوم‌بروماید (1 میلی‌گرم در میلی‌لیتر) با دستگاه ایلیومیناتور مورد ‌بررسی قرار گرفت. در مطالعه حاضر به‌منظور واکنش زنجیره‌‍‌ای پلیمراز مربوط به ژن House Keeping از توالی اولیگونوکلئوتیدی پرایمرهای GAPDH-F و GAPDH-R استفاده ‌شد. توالی پرایمرهای مورد استفاده به شرح زیر بود: CCTTCATTGACCTCAACTACAT GAPDH-F: و CCAAAGTTGTCATGGATGACC GAPDH-R:

جهت آزمون PCR 5/12 میکرولیتر از محلول آماده کار (مسترمیکس 2X شرکت BIONEER کشور کره، 106S-CSTMK.Cat No)، 1 میکرولیتر از هر پرایمر F و R (با غلظت 10 پیکومول در میکرولیتر)، 3 میکرو لیتر از DNA استفاده گردید و حجم نهایی با آب مقطر به 25 میکرولیتر رسید. واکنش PCR در دستگاه ترموسیکلر (Techne,512-TC) در 36 سیکل با واسرشت اولیه 94 درجه 5 دقیقه، با تکرار سه مرحله واسرشت 94 درجه 60 ثانیه، مرحله اتصال 61 درجه 60 ثانیه و مرحله همانندسازی 72 درجه 60 ثانیه انجام‌ پذیرفت و در انتها 72 درجه به‌مدت 5 دقیقه سیکل انتهایی همانندسازی خاتمه ‌یافت. 5 میکرو لیتر از محصول PCR در ژل آگارز 5/1 درصد با بافر TBE (1X) با ولتاژ 100 به‌مدت یک‌ ساعت الکتروفورز گردید و پس از رنگ‌آمیزی با اتیدیوم‌بروماید (1 میکروگرم در میلی‌لیتر) با دستگاه ایلومیناتور مورد‌ بررسی قرار گرفت.

آزمایشات بیوشیمی: بیمارانی که در اولتراسونوگرافی وجود کیست در آن‌ها تأیید شده بود، به‌منظور ارزیابی میزان پیشرفت بیماری، مقادیر فاکتورهای کلیوی ازت اوره‌ی خون، کراتینین سرم و فسفر اندازه‌گیری ‌شد. به این منظور از ورید سفالیک هر حیوان 3 سی‌سی خون جمع‌آوری گردید و در لوله‌های آزمایش بدون ماده ضد انعقاد در فاصله زمانی کوتاه به آزمایشگاه ارسال ‌شد.

تجزیه ‌و تحلیل آماری: آنالیز آماری داده‌ها به کمک نرم‌افزار SPSS ورژن 20 انجام شد. در همه آزمون‌های آماری 05/0P≤ معنی‌دار در نظر گرفته‌ شد. درجه توافق دو روش تشخیصی اولتراسونوگرافی و PCR با کاپا محاسبه و حساسیت، ویژگی، ارزش اخباری مثبت و منفی روش اولتراسونوگرافی هم به کمک نرم‌افزار Stata محاسبه ‌شد.

نتایج

در روش اولتراسونوگرافی، در 32 مورد (33 درصد) کیست‌های بدون اکوژنسیته در قسمت‌های مختلف کلیه تشخیص ‌داده‌ شد (تصویر 1،2). بیشترین شیوع بیماری در گروه سنی 24-2 ماه و کم‌ترین میزان در سنین 72-49 ماه و بالاتر از 120 ماه بود. تفاوتی از نظر شیوع بیماری در دو جنس نر (5/16 درصد) و ماده (5/16 درصد) وجود نداشت. اکثر مبتلایان (5/53 درصد) درجه 3 بیماری را نشان دادند و کم‌ترین فراوانی (3 درصد) مربوط به درجه 1 بیماری بود (جدول 3). تعداد کیست‌ها در هر کلیه از 1 تا 20 عدد متغیر بود. قطر کوچک‌ترین کیست مشاهده‌ شده 09/0 سانتی‌متر و بزرگ‌ترین کیست 24/4 سانتی‌متر بود که در یک بیمار 11 ساله ماده ازوتمیک مشاهده‌ شد. در دو مورد (25/6 درصد) مربوط به یک گربه نر 3 ساله و یک گربه ماده 11 ساله، وجود کیست در کبد به شکل هم‌زمان تشخیص‌ داده ‌‌‌‌‌‌شد. در سایر ارگان‌های احشایی از جمله پانکراس و طحال کیستی مشاهده ‌نشد.

از 32 موردی که وجود کیست در آن‌ها با روش سونوگرافی تشخیص ‌داده‌ شده ‌بود، در 3 مورد (3/9 درصد) مقادیر ازت اوره‌ خون و کراتینین سرم غیرطبیعی بود. غلظت فسفر در 2 مورد از موارد ازوتمیک بالاتر از حد طبیعی بود. میانگین تعداد کیست‌ها، در دو گروه مبتلا به ازوتمی و فاقد علائم بالینی دارای اختلاف آماری بود (05/0= α، 047/0P=). ولی در اندازه کیست‌ها در این دو گروه تفاوت معنی‌داری یافت نشد (05/0= α، 09/0P=). از 97 قلاده گربه پرشین مورد بررسی، 45 مورد (46 درصد) با استفاده از روش مولکولی وجود بیماری در آن‌ها تأیید‌ شد. در 32 مورد (33 درصد) بین روش مولکولی و سونوگرافی همخوانی وجود داشت. با این‌ حال 13 مورد (29 درصد)، تنها با روش مولکولی مورد تشخیص قرار گرفتند. تمام 45 مورد دارای ژن جهش ‌یافته‌ PKD1، وزن مولکولی 400 جفت باز را در ژل آگارز نشان ‌دادند. در کنترل مثبت ژن GAPDH نیز باند 400 جفت‌باز مشاهده ‌شد و در کنترل منفی با آب مقطر باندی مشاهده ‌نشد. کاپا 725/0 (859/0- 592/0Cl:) نشان‌دهنده درجه توافق خوب برای این دو روش ذکر شده می‌باشد. حساسیت و ویژگی اولتراسونوگرافی به ترتیب 11/71 درصد (63/83- 69/55Cl:)، 100 درصد (100 درصد-15/93 درصدCl:) ارزش اخباری مثبت 100 درصد و ارزش اخباری منفی 80 درصد (35/86 درصد-66/71 درصدCl: ) محاسبه ‌شد.

بحث

بیماری کلیه پلی‌کیستیک اولین بار توسط Crowell و همکاران در سال 1979 به‌عنوان یک بیماری ژنتیکی در گربه‌های پرشین مورد شناسایی قرار گرفت (9). گزارشات پیشین که شباهت‌های ADPKD گربه‌ها و ADPKD انسان‌ها را تأیید کرده‌اند، گربه‌ها را به‌عنوان مدل‌های ارزشمندی جهت تحقیق بر روی این بیماری کشنده در انسان و گسترش روش‌های درمان آن معرفی کرده‌اند (12،19).

اولتراسونوگرافی متداول‌ترین روش تصویربرداری جهت تشخیص کیست‌های ان‌اکوییک ناشی از این بیماری در کلیه است (23). در مطالعه حاضر کمترین تعداد کیست 1 عدد و در برخی از گربه‌های مبتلا بیش از 20 کیست مشاهده‌ شد. حضور یک کیست ممکن است با مواردی از قبیل تومور، آبسه، لمفوم و همانژیوم اشتباه گرفته ‌شود. کیست‌های تکی کلیه در سگ و انسان متداول هستند و با افزایش سن میزان بروز آن‌ها افزایش می‌یابد (11). در حالی ‌که مشاهده کیست‌های تکی در گربه‌ها غیرمعمول می‌باشد (30). در مطالعه حاضر وجود بیماری کلیه پلی‌کیستیک در مواردی که تنها یک کیست وجود داشت با روش مولکولی مورد تأیید قرار گرفت. همچنین پراکندگی کیست‌های مشاهده ‌شده در بیماران در هر دو کلیه به‌صورت متقارن بود که با مطالعات گذشته هم‌خوانی دارد (23).

در مطالعه حاضر با استفاده از سونوگرافی میزان فراوانی PKD در میان گربه‌های پرشین و مخلوط پرشین 32 مورد (33 درصد) بود که این میزان در مطالعات مشابه 36 تا 42 درصد عنوان ‌شده ‌بود. همچنین میزان فراوانی با روش مولکولی در مطالعه حاضر 45 مورد (46 درصد) بود که در مطالعات گذشته نیز که از روش مولکولی استفاده ‌کرده ‌بودند این میزان 5/27 و 33 درصد گزارش ‌شده ‌بود (16). نتایج مطالعه حاضر نشان می‌دهد فراوانی بیماری در گربه‌های این بررسی بیشتر است. این نتیجه می‌‌تواند به‌علت عدم وجود برنامه خاص به‌منظور شناسایی گربه‌های پرشین دارای ژن بیمار و بنابراین عدم حذف آن‌ها از برنامه‌های پرورشی باشد. حساسیت سونوگرافی در این مطالعه 11/71 درصد بود که پایین‌‌تر از مطالعات پیشین می‌باشد، درحالی‌که ویژگی محاسبه‌ شده در این مطالعه 100 درصد به‌دست ‌آمد که نسبت به مطالعات پیشین بالاتر است (1،6). در شرایطی که اندازه کیست کوچک و تعداد آن‌ها کم باشد، به‌خصوص در سنین پایین و در کیست‌هایی که در نواحی مرکزی کلیه قرار داشته باشند ممکن است با سونوگرافی تشخیص داده ‌نشوند لذا استفاده از روش مولکولی به‌منظور تشخیص این موارد توصیه می‌شود. ناگفته نماند از محدودیت‌های روش مولکولی می‌توان به عدم توانایی تشخیص مواردی اشاره‌ داشت که جهش ژنی در نقاط دیگر کروموزوم به‌وجود آمده ‌است. همچنین این روش اطلاعاتی در خصوص اندازه و تعداد کیست‌ها و میزان پیشرفت بیماری در اختیار کلینیسین‌ها قرار نمی‌دهد. با این‌ حال با استفاده از این روش امکان بررسی بیماری در مراحل اولیه زندگی و حذف موارد مبتلا از برنامه‌‌های پرورشی وجود خواهد داشت.

در مطالعه حاضر گربه‌های مبتلا دارای بازه سنی 2 ماه تا 168 ماه، با میانگین سنی 72 ماه بودند. بیشترین شیوع بیماری در گروه سنی  2-24 ماه و کم‌ترین میزان شیوع در گروه‌های سنی 72-49 ماه و بیشتر از 120 ماه بود. این‌که در سنین بالا میزان ابتلا کمتر بوده است می‌تواند به‌دلیل پیشرفت بیماری به دنبال افزایش اندازه و تعداد کیست‌ها و نارسایی کلیوی حاصل از آن و به‌دنبال آن از بین رفتن گربه‌های بیمار به‌دلیل پیشرفت بیماری و ازتمی حاصل از آن باشد. همچنین درصد بالای مبتلایان در جوان‌‌ترها می‌تواند به علت عدم توجه به غربالگری بیماری و شناسایی گربه‌های دارای ژن ابتلا به بیماری PKD و حذف آن‌ها از برنامه‌های پرورشی باشد.

اکثر بیماران در مطالعه حاضر به درجه 3 بیماری مبتلا بودند و کم‌ترین فراوانی مربوط به درجه 1 بیماری بود. میزان فراوانی درجه سه بیماری در گروه سنی 48-24 ماه و همچنین فراوانی درجه‌یک در گروه سنی 72-49 ماه و فراوانی درجه ‌دو و چهار در گروه سنی 24-2 ماه بیشتر بود. از آن‌جا که این بیماری ماهیت پیشرونده دارد و با افزایش سن، اندازه کیست‌ها و نیز کلیه‌ها بزرگ‌تر می‌شود، این یافته می‌تواند به علت میانگین سنی بالای بیماران شرکت داده‌‌ شده در مطالعه حاضر باشد.

در مطالعه حاضر بر اساس آزمایشات بیوشیمیایی 3 (3/9 درصد) مورد از مبتلایان به بیماری کلیه پلی‌کیستیک، ازوتمیک بودند. ایجاد علائم اورمی در یک قلاده گربه 3 ساله تحت بررسی مبتلا به کیست کبدی هم‌‌زمان نشان ‌داد که سرعت رشد کیست‌ها و افزایش تعداد آن‌ها یکسان نیست و نمی‌توان ابتلا به نارسایی کلیوی در گربه‌های دارای کیست کلیوی را تنها به افزایش سن مربوط دانست. مطالعات انسانی نشان ‌می‌دهند در مواردی‌که فرد مبتلا دارای شکل مغلوب بیماری باشد، از سرعت رشد بیشتری در کیست برخوردار خواهد بود و علائم نارسایی کلیوی و مرگ زودتر حادث می‌شود (15). ARPKD (بیماری کلیه پلی‌کیستیک اتوزومال مغلوب) یکی از معمول‌ترین بیماری‌های کیستیک کلیه در کودکان می‌باشد که شیوع حدود یک در 20000 تولد دارد. در این بیماری جهش در نقطه p6 کروموزوم و در ژن PKHD1 (بیماری کبد و کلیه پلی‌کیستیک) رخ می‌دهد. جنین‌های مبتلا فنوتیپ "پاتر" (Potter phenotype) را نشان می‌دهند. (دارای بینی پهن، چشم‌های بافاصله، گوش‌های پایین‌‌تر از سطح معمول، فک پایین کوتاه هستند). همچنین ریه در این جنین‌ها از رشد کافی برخوردار نبوده و نوزاد با مشکل تنفسی متولد می‌شود (3). همچنین براساس نتایج مطالعه حاضر بسیاری از گربه‌ها (7/90 درصد) علیرغم دارا بودن کیست کلیوی دچار علائم اورمی و افزایش پارامترهای بیوشیمیایی ازوتمی نبودند. از آن‌جاکه سن بیشتر این حیوانات کم‌تر از 10 سال بوده ‌است، این احتمال وجود دارد که با افزایش سن حیوان و رشد بیشتر اندازه و تعداد کیست‌ها در آینده دچار علائم نارسایی کلیوی شوند. هرچند دلیل مرگ آن‌ها می‌تواند صرفاً به ایجاد نارسایی کلیوی در آن‌ها مربوط نباشد.

حضور کیست‌های هم‌زمان کبد و کلیه در مطالعات پیشین گزارش ‌شده ‌است (13،18). در مطالعه حاضر 2/6 درصد (یک قلاده گربه نر 3 ساله و یک قلاده گربه ماده 11 ساله) از مبتلایان به کلیه پلی‌کیستیک دارای کیست هم‌زمان در کبد نیز بوده‌اند. در هر دو مورد تنها یک کیست در کبد مشاهده‌ شد. شیوع کیست‌های کبدی در مبتلایان به کلیه پلی‌کیستیک در مطالعه Bosje و همکاران در سال 1998، 22 درصد گزارش ‌شد (7). همان‌طور که قبلاً گفته‌ شد شکل مغلوب بیماری (ARPKD) نسبت به شکل غالب بیماری (ADPKD) علائمی شدیدتر و مرگ‌ و میر بیشتری ایجاد می‌کند. میزان فاکتورهای کبدی در موارد دارای کیست هم‌زمان کبد و کلیه در بازه طبیعی قرار داشت که این یافته با مطالعات پیشین (20) مشابهت داشت. Skrodzki و همکاران در سال 1992 وقوع هم‌زمان کیست پانکراس و کلیه را در گربه پرشین گزارش‌ کردند (25). در مطالعه حاضر موردی از کیست پانکراس در مبتلایان به کلیه پلی‌کیستیک یافت ‌نشد. شیوع هم‌زمان سنگ‌های کلیوی و PKD در مطالعات پیشین گزارش ‌شده‌ است. اغلب در بیماران مبتلا به ADPKD به دلیل عوامل مکانیکی و متابولیکی، به‌طور ثانویه سنگ‌های کلیوی در 2 درصد مبتلایان مشاهده می‌شوند. حضور کیست‌‌های بزرگ، که مانع از عملکرد طبیعی سیستم جمع‌آوری ادرار می‌شود، و همچنین کاهش دفع ادراری سیترات به‌همراه افزایش دفع اگزالات و اسیداوریک در ادرار از عوامل مستعد کننده ایجاد سنگ‌های ادراری در گربه‌های مبتلا به کیست برشمرده شده‌اند (10،28،29). در مطالعه حاضر هیچ موردی از سنگ کلیه و سنگ‌های مجاری ادراری در مبتلایان به کلیه پلی‌کیستیک مشاهده ‌نشد.

در مجموع از آن‌جا که در نارسایی‌های مزمن کلیوی در گربه‌ها به دلیل جایگزینی بافت همبند، معمولاً اندازه کلیه کوچک‌تر و هم‌زمان به ازوتمی آزمایشگاهی نیز مبتلا می‌شوند، از نظر بالینی با توجه به نتایج مطالعه حاضر باید کلینیسین‌ها توجه داشته ‌باشند که در گربه‌های نژاد پرشین صرفاً نمی‌توان بر اساس اندازه کلیه در خصوص درجه پیشرفت بیماری و فاصله زمانی ایجاد ازوتمی قضاوت نمود. هرچند بدیهی است احتمال ازوتمی در بیماران دارای کیست‌های بیشتر با اندازه بزرگ‌تر محتمل‌تر خواهد بود. نتایج مطالعه حاضر نشان‌داد که بیماری کلیه پلی‌کیستیک دارای شیوع قابل ‌توجهی در گربه‌های پرشین و مخلوط پرشین می‌باشد و در مبتلایان اندازه کیست‌ها و تعداد آن‌ها متغیر و در هر دو کلیه به شکل متقارن ایجاد می‌شوند. همچنین با کمک یافته‌های اولتراسونوگرافی و آزمایشات بیوشیمی مشخص‌شد، هرچه تعداد و اندازه کیست‌ها بیشتر باشد، احتمال ایجاد ازوتمی بیشتر خواهد ‌بود. با این‌حال صرفاً حضور کیست در کلیه‌ها نمی‌تواند دلیل کاهش عملکرد آن‌ها باشد. با توجه به سهولت نمونه‌برداری جهت انجام آزمایش مولکولی بدون توجه به هزینه‌های مترتب و وسایل و تجهیزات مورد نیاز، این روش به‌منظور غربالگری بیماری در مراکز پرورشی توصیه می‌شود. بدین ترتیب استفاده از روش‌های مولکولی در کنار روش‌های فوق می‌تواند در تشخیص بیماری در مراحل اولیه بسیار حائز اهمیت باشد.

سپاسگزاری

در انتها از تمام کارکنان بیمارستان حیوانات کوچک دانشکده دامپزشکی دانشگاه تهران صمیمانه قدردانی می‌شود.

تعارض منافع

بین نویسندگان تعارض در منافع گزارش نشده است.

  1. Barrs, V.R., Gunew, M., Foster, S.F., Beatty, J.A., Malik, R. (2001). Prevalence of autosomal dominant polycystic kidney disease in Persian cats and related‐breeds in Sydney and Brisbane. Aust Vet J, 79, 257-9. https://doi.org/10.1111/j.1751-0813.2001.tb11977.x PMID: 11349412
  2. Barthez, P.Y., Rivier, P., Begon, D. (2003). Prevalence of polycystic kidney disease in Persian and Persian related cats in France. J Feline Med Surg, 5, 345-7. https://doi.org/10.1016%2FS1098-612X%2803%2900052-4 PMID: 14623204
  3. Bergmann, C., Senderek, J., Küpper, F., Schneider, F., Dornia, C., Windelen, E., Onuchic, L.F. (2004). PKHD1 mutations in autosomal recessive polycystic kidney disease (ARPKD). Human Mutation, 23, 453-63.
  4. Biller, D.S., Chew, D.J., DiBartola, S.P. (1990). Polycystic kidney disease in a family of Persian cats. J Am Vet Med Assoc, 196, 1288-90. PMID: 2185204
  5. Biller, D.S., DiBartola, S.P., Eaton, K.A., Pflueger, S., Wellman, M.L., Radin, M.J. (1996). Inheritance of polycystic kidney disease in Persian cats. J Hered, 87, 1-5. https://doi.org/10.1093/oxfordjournals.jhered.a022945 PMID: 8742815
  6. Bonazzi, M., Volta, A., Gnudi, G., Cozzi, M.C., Strillacci, M.G., Polli, M., Bertoni, G. (2009). Comparison between ultrasound and genetic testing for the early diagnosis of polycystic kidney disease in Persian and Exotic Shorthair cats. J Feline Med Surg, 11, 430-4. https://doi.org/10.1016%2Fj.jfms.2008.10.003 PMID: 19046910
  7. Bosje, J.T., Van den Ingh, T.S.G.A.M., van der Linde‐Sipman, J.S. (1998). Polycystic kidney and liver disease in cats. Vet Q, 20, 136-9. https://doi.org/10.1080/01652176.1998.9694858 PMID: 9810628
  8. Cannon, M.J., Barr, F.J., Rudorf, H., Bradley, K.J., Gruffydd-Jones, T.J., MacKay, A.D. (2001). Prevalence of polycystic kidney disease in Persian cats in the United Kingdom. Vet Rec, 149, 409-11. http://dx.doi.org/10.1136/vr.149.14.409 PMID: 11678212
  9. Crowell, W.A., Hubbell, J.J., Riley, J.C. (1979). Polycystic renal disease in related cats. j Am Vet Med Assoc, 175, 286-8. PMID: 500456
  10. Dalgaard, O.Z. (1957). Bilateral polycystic disease of the kidneys; a follow-up of two hundred and eighty-four patients and their families. Acta Med Scand Suppl, 328, 1-255. PMID: 13469269
  11. DiBartola, S.P., Rutgers, H.C., Zack, P.M., Tarr, M.J. (1987). Clinicopathologic findings associated with chronic renal disease in cats: 74 cases (1973-1984). J Am Vet Med Assoc, 190, 1196-1202. PMID: 3583899
  12. Eaton, K.A., Biller, D.S., DiBartola, S.P., Radin, M.J., Wellman, M.L. (1997). Autosomal dominant polycystic kidney disease in Persian and Persian-cross cats. Vet Pathol, 34, 117-26. https://doi.org/10.1177%2F030098589703400204 PMID: 9066078
  13. Feldhahn J. (1990). Polycystic kidney disease in a persian cat. Aust Vet Pract, 201, 44, 46.
  14. Gerwing, M., Michele, U., Kramer, M., Schimke, E. (1999). PKD (Polycystic Kidney Disease)-Polycystic syndrome. Praktische Tierazt-Hannover, 80(5), 374-397.
  15. Habte, B., Abraha, A. (1983). Adult polycystic kidney disease. Ethiop Med J, 21, 193-6.
  16. Helps, C.R., Tasker, S., Barr, F.J., Wills, S.J., Gruffydd-Jones, T.J. (2007). Detection of the single nucleotide polymorphism causing feline autosomal-dominant polycystic kidney disease in Persians from the UK using a novel real-time PCR assay. Mol Cell Probs, 21, 31-4. https://doi.org/10.1016/j.mcp.2006.07.003 PMID: 1695059
  17. Kääriäinen, H., Koskimies, O., Norio, R. (1988). Dominant and recessive polycystic kidney disease in children: evaluation of clinical features and laboratory data. Pediat Nephrol, 2, 296-302. https://doi.org/10.1007/BF00858681 PMID: 3153029
  18. Lulich, J.P., Osborn, C.A.,Walter, P.A.,Obrien, T.D. (1988). Feline idiopathic polycystic kidney disease. Compend Contin Educ Vet, 10, 1030-40.
  19. Lyons, L.A., Biller, D.S., Erdman, C.A., Lipinski, M.J., Young, A.E., Roe, B.A., Grahn, R.A. (2004). Feline polycystic kidney disease mutation identified in PKD1. J Am Soc Nephrol, 15, 2548-55. https://doi.org/10.1097/01.ASN.0000141776.38527.BB PMID: 15466259
  20. Milutinovic, J., Fialkow, P.J., Rudd, T.G., Agodoa, L.Y., Phillips, L.A., Bryant, J I. (1980). Liver cysts in patients with autosomal dominant polycystic kidney disease. Am J Med, 68, 741-4.
  21. Nivy, R., Lyons, L.A., Aroch, I., Segev, G. (2015). Polycystic kidney disease in four British shorthair cats with successful treatment of bacterial cyst infection. J Small Anim Pract, 56, 585-9. https://doi.org/10.1111/jsap.12327 PMID: 25677715
  22. Ottesen, N. (2004). Polycystic kidney disease in Persian cats: comparison of renal ultrasonography at the age of 3 and 12 months. Vet Radiol Ultrasound, 45, 600.in Europe: prevalence and survival—an analysis of data from the ERA-EDTA Registry. Nephrol Dial Transplant, 29, 15-25. https://doi.org/10.1093/ndt/gfu017 PMID: 25165182
  23. Reichle, J.K., DiBartola, S.P., Léveillé, R. (2002). Renal ultrasonographic and computed tomographic appearance, volume, and function of cats with autosomal dominant polycystic kidney disease. Vet Radiol Ultrasound,43, 368-73. https://doi.org/10.1111/j.1740-8261.2002.tb01020.x PMID: 12175002
  24. Scalon, M.C., da Silva, T.F., Aquino, L.C., Carneiro, F.T., Lima, M.G.D.M., Lemos, M.D.S., Paludo, G.R. (2014). Touchdown polymerase chain reaction detection of polycystic kidney disease and laboratory findings in different cat populations. J Vet Diagno Invest, 26, 542-46. https://doi.org/10.1177%2F1040638714536561 PMID: 24916445
  25. Skrodzki, M., Kattinger, P., Trautvetter, E. (1992). Polyzystische veränderungen in leber, niere, pankreas und bronchialdrüsen bei einer perserkatze. Kleintierpraxis, 37, 599-605.

26.  Spithoven, E.M., Kramer, A., Meijer, E., Orskov, B., Wanner, C., Abad, J.M., Finne, P. (2014). Renal replacement therapy for autosomal dominant polycystic kidney disease (ADPKD) in Europe: prevalence and survival--an analysis of data from the ERA-EDTA registry, Nephrol Dial Transplant, 4, 15-25. https://doi.org/10.1093/ndt/gfu017 PMID: 25165182

  1. Torres, V.E. (2010). Treatment strategies and clinical trial design in ADPKD. Adv Chronic Kidney Dis, 17, 190-204. https://doi.org/10.1053/j.ackd.2010.01.006 PMID: 20219622
  2. Torres, V.E., Wilson, D.M., Hattery, R.R., Segura, J.W. (1993). Renal stone disease in autosomal dominant polycystic kidney disease. Am J Kidney Dis, 22, 513-19.
  3. Torres, V.E., Erickson, S.B., Smith, L.H., Wilson, D., Hattery, R.R., Segura, J.W. (1988). The association of nephrolithiasis and autosomal dominant polycystic kidney disease. Am J Kidney Dis, 11, 318-25. https://doi.org/10.1016/S0272-6386(88)80137-9 PMID: 3354568
  4. Walter, P.A., Johnston, G.R., Feeney, D.A., O'Brien, T.D. (1988). Applications of ultrasonography in the diagnosis of parenchymal kidney disease in cats: 24 cases (1981-1986). J Am Vet Med Assoc, 192, 92-8. PMID: 3277935