بیان ژن‌های آپوپتوز در لنفوسیت‌های گاوی در پاسخ به مایع کیست هیداتید

نوع مقاله: انگل شناسی و بیماری های انگلی

نویسندگان

1 گروه انگل و قارچ‌شناسی، دانشکده پزشکی دانشگاه علوم پزشکی اصفهان، اصفهان، ایران

2 گروه فیزیولوژی دام، دانشگاه آزاد خوراسگان، اصفهان، ایران

چکیده

زمینۀ مطالعه:  هیداتیدوز عفونتی با انتشار جهانی است که توسط سستودهای جنس اکینوکوکوس ایجاد می‌شود. توانایی زنده ‌ماندن انگل به مدت طولانی در میزبان نشان ‌دهنده آن است که انگل دارای استراتژی‌هایی برای فرار از سیستم دفاعی میزبان است. مرگ‌های ایجاد شده توسط عفونت‌های انگلی اغلب در اثر آسیب‌های بافتی است که نتیجه یک نوع مرگ سلول میزبان است که تحت عنوان آپوپتوز شناخته شده است. بنابراین مهم است که نقش آپوپتوز را که توسط انگل ایجاد و یا کنترل می‌شود را کشف و بشناسیم.
هدف: بررسی اثر سیتوتوکسیسیتی، القاء آپوپتوز و سازوکار القاء آپوپتوز مایع هیداتید گاوی بر روی لنفوسیت‌های گاو به عنوان سلول‌های کارآمد ایمنی علیه اکینوکوکوس گرانولوزوس می‌باشد.
روش‌کار: در این پژوهش ابتدا اثر سیتوتوکسیسیتی مایع هیداتید گاوی بر روی لنفوسیت های گاو با روش MTS بررسی شد. سپس میانگین بیان ژن‌های آنتی‌آپوپتوتیک Bcl-2 و پروآپوپتوتیک Bax و شاخص آپوپتوزCaspase 3در لنفوسیت‌های گاوی تیمار شده با مایع کیست هیداتید بارور و غیربارور با روش Real Time PCR اندازه‌گیری شد.
نتایج: میانگین زیستی لنفوسیت‌ها در گروه‌های تیمارشده با مایع کیست هیداتید بارور و غیربارور نسبت به یکدیگر و گروه کنترل اختلاف معنی‌دار (05/0 >P) داشت. میانگین بیان ژنBax در لنفوسیت‌های تیمار شده با مایع کیست بارور در مقایسه با لنفوسیت‌های تیمار شده با مایع کیست غیربارور و کنترل اختلاف معنی دار (046/0= P) داشت. اگرچه میانگین Caspase 3در این گروه بالاتر بیانشد ولی اختلاف معنی دار نبود. همچنین بیان ژن Bcl-2 در لنفوسیت‌های تیمار شده با مایع کیست بارور در مقایسه با غیربارور و کنترل، پائین‌ و غیرمعنی دار به‌ دست آمد.
نتیجه‌گیری نهایی: این بررسی‌ها تعیین می‌کند که مولکول‌های مایع کیست هیداتید قادر به ایجاد آپوپتوز در سلول‌های ایمنی میزبان در محیط آزمایشگاهی می‌باشند و انگل با مهار پاسخ ایمنی میزبان از مسیر آپوپتوز، توانایی زنده‌ ماندن به مدت طولانی را در بدن میزبان دارد.

کلیدواژه‌ها


عنوان مقاله [English]

Apoptosis Genes Expression in Bovine Lymphocytes in Response to Fertile and Infertile Hydatid Cyst Fluid

نویسندگان [English]

  • Maryam Rahmani-Dehaghani 1
  • Sepideh Tolouei 1
  • Hossain Yousofi-darani 1
  • Mohamad Aliyan 2
  • zahra Ghayour-Najafabadi 1
1 Department of Parasitology and Mycology, Medical School, Isfahan University of Medical Sciences, Iran
2 Department of Veterinary Physiology, Islamic Azad University Isfahan Khorasgan Branch, Iran
چکیده [English]

BACKGROUND: Hydatid cyst is an infection with global distribution that is caused by the larval stage of the tapeworm of Echinococcus. The long-term survival of the hydatid in the host shows the parasite has advanced highly effective strategies for escaping the host defense. Deaths are caused by parasitic infections which are often due to tissue damages that result in host cell death, this is known as apoptosis. So it is important to know the process and the role of apoptosis that is created or controlled by a parasite.
OBJECTIVES: Investigation of cytotoxicity effect, induction of apoptosis and mechanism of induction of apoptosis of cattle hydatid fluid on bovine lymphocyte cells as efficient cells of immunity were studied.
METHODS: In this study, the cytotoxicity effect of bovine hydatid fluid (HF) on lymphocyte cells was investigated as effective immune cells against Echinococcus granulosus by MTS method. Then the mean of the expression of caspase-3, Bax and Bcl-2 genes in bovine lymphocytes treated/untreated was determined with fertile and infertile hydatid cyst fluid using Real Time PCR method.
RESULTS: The viability mean of lymphocytes was significantly lower in the fertile HF treated lymphocytes compared to both infertile HF-treated lymphocytes and cell control. Bax gene expression was significantly (P=0.046) higher in the fertile HF-treated lymphocytes compared to both infertile HF-treated lymphocytes and cell control. Although Caspase 3 was higher in this group, the difference was not significant. Also, expression of Bcl-2 gene in fertile fluid treated lymphocytes was found to be lower than that of infertile and control.
CONCLUSIONS: Present study indicates that hydatid cyst fluid molecules can probably induce apoptosis in immune cells in vitro and the parasite’s ability to stay alive for a long time in the host by controlling the host immune response from the apoptosis pathway.

کلیدواژه‌ها [English]

  • Cytotoxicity
  • Apoptosis
  • Bax
  • caspase 3
  • Bcl-2

هیداتیدوز یک عفونت انگلی است که توسط مرحله‌ی لاروی کرم اکینوکوکوس گرانولوزوس ایجاد می‌شود و به عنوان یک بیماری زئونوز مهم در علم پزشکی و دامپزشکی مطرح است. در سیر تکاملی این انگل دو میزبان پستاندار وجود دارد. کرم بالغ در روده کوچک سگ و سگ‌سانان (میزبان نهایی) ایجاد تخم‌هایی می‌‌کند که حاوی جنین شش ‌قلابه آلوده‌کننده است. بعد از خوردن تخم توسط میزبان واسط (انسان و علفخواران) مرحله لاروی در ارگان‌های داخلی، اساسا کبد و ریه رشد و تکامل‌یافته و ایجاد کیسه‌های پر از مایع می‌‌کند(6,17).

توانایی زنده‌ماندن کیست هیداتید درون میزبان واسط به مدت طولانی  نشان‌دهنده آن است که انگل دارای استراتژی‌هایی برای فرار از سیستم دفاعی میزبان است. علاوه بر سد فیزیکی لایه فیبروزی کیست، ترکیبات آنتی‌‌ژنیک مایع کیست هم در فرار انگل از سیستم ایمنی میزبان درگیر است (20). در سال‌های اخیر مطالعات متعددی بر روی مکانیسم‌های درگیر در استقرار کیست هیداتید انجام شده است که نقش مولکول‌‌های تنظیم ایمنی را مهم دانسته‌اند. این مولکول‌ها یا بطور مستقیم عملکرد بعضی از سلول‌های ایمنی را تضعیف می‌کنند یا سبب تحریک جمعیتی دیگر از سلول‌ها می‌شوند که زمینه فرار انگل از سیستم ایمنی میزبان را فراهم می‌کند (10). سپس این سوال طرح شد که انگل برای تعدیل سیستم ایمنی میزبان از چه راهکارهایی استفاده می‌کند؟ در پاسخ به این سوال پژوهش‌هایی انجام شد که نتایج نشان داد کیست هیداتید قادر به ایجاد تغییراتی در الگوی سیتوکین‌های تولید شده از میزبان در پاسخ Th2 و نقش مهم سلول‌های تنظیم‌گر (Treg) در تکامل عفونت هیداتید است که ارتباط با بقای انگل در بدن میزبان دارد (5,14). همچنین نتایج مطالعات نشان داد که فاکتورهای محلول داخل مایع کیست هیداتید ممکن است به سیستم لنفاوی میزبان دسترسی پیدا کرده و با فعال‌ کردن سلول‌های Treg سیتوکین های مهم در تعدیل و سرکوب التهاب مثل IL10 و(Transforming Growth Factor beta) TGF-ß تولید می گردد. در این صورت با توقف تحریک پاسخ Th1/Th2  عملکرد سیستم ایمنی میزبان تنظیم می شود (24).

به طور کلی، انگل با کمک دو مکانیسم، پاسخ ایمنی میزبان را مهار می‌‌کند: اولین مکانیسم، فرار از سیستم ایمنی و تبدیل به کیست است که از اثرات آسیب پاسخ ایمنی میزبان جلوگیری می‌‌کند و دومین مکانیسم، واسطه‌های ایمنی است که به طور فعال در کاهش و تعدیل پاسخ سیستم ایمنی میزبان تاثیر دارد. ملکول‌های واسط ایمنی موجود در مایع کیست هیداتید در پاسخ ایمنی ذاتی، پاسخ ایمنی اکتسابی، ظهور پاسخ‌های ایمنی هومورال و سلولی نقش دارند (21). اخیرا آپوپتوز به‌ عنوان بخش مهمی از ایمنی ذاتی میزبان در سرکوب انگل‌ها و همچنین دفاع انگل در مقابل سیستم دفاعی میزبان و تعدیل آن مورد بررسی قرار گرفته است.

آپوپتوز یک نوع مرگ برنامه ریزی شده سلول است که توسط تغییرات مرفولوژیک و بیوشمیایی شناسایی می‌شود. در این مکانیسم 2 مسیر مهم خارجی (رسپتورهای مرگ) و داخلی (میتوکندریال) نقش دارند که فاکتورهای متعدد در این مسیرها فعالیت دارند. آبشار آنزیمی کاسپازها و پروتئین‌های خانوادهBcl-2،دو عضو مهم مرگ برنامه‌ریزی شده داخلی می‌باشند. در آبشار آنزیمی، Caspase 3 و در خانواده Bcl-2 پروتئین‌ پروآپوپتوتیکBax  و آنتی آپوپتوتیک Bcl-2، مهمترین نقش را در آپوپتوز ایفا می‌کنند (7).

مرگ‌های ایجاد شده توسط عفونت‌های انگلی اغلب در اثر آسیب‌های بافتی است که نتیجه یک نوع مرگ سلول میزبان است که تحت عنوان آپوپتوز شناخته شده است (3). با بررسی تحقیقات انجام شده در آپوپتوز سلول‌های سیستم ایمنی میزبان توسط انگل‌ها، به این نتیجه می‌توان دست یافت که تعدادی از انگل‌ها قادر به تعدیل پاسخ ایمنی میزبان از طریق القای آپوپتوز سلول‌های ایمنی بوده و در واقع انگل از سیستم ایمنی میزبان فرار می‌کند (8،18،22). در مورد انگل اکینوکوکوس کمتر به این مساله پرداخته شده است بنابراین کشف و شناسایی طرز عمل و نقش آپوپتوزی که توسط انگل ایجاد و یا کنترل می شود مهم است در مطالعه حاضر اثر سیتوتوکسیسیتی، القاء آپوپتوز و سازوکار القاء آپوپتوز مایع هیداتید گاوی بر روی سلول‌های لنفوسیت گاو به عنوان سلول‌های موثر ایمنی علیه اکینوکوکوس گرانولوزوس بررسی شد. از آنجایی که مطالعات تاکید بر تنوع ترکیبات نمونه‌های مایع هیداتید دارد و این تنوع ممکن است در عملکرد تنظیم سیستم ایمنی علیه کیست موثر باشد، لذا در این مطالعه اثر مایع هیداتید کیست‌های بارور و غیربارور در القاء آپوپتوز نیز مقایسه گردید.

مواد و روش‌کار

به ‌دست ‌آوردن کیست‌ها: با مراجعه به کشتارگاه فساران اصفهان کبدهای آلوده به کیست هیداتید گاوی به آزمایشگاه انگل شناسی دانشکده پزشکی دانشگاه علوم پزشکی اصفهان انتقال داده شد. جهت به‌ دست‌ آوردن مایع کیست و مشخص‌کردن وضعیت کیست‌ها (بارور یا استریل بودن)، مایع کیست از نظر وجود یا عدم وجود پروتواسکولکس و قلاب‌ها بررسی گردید (1). مایع 3 عدد کیست بارور و 3 عدد کیست غیربارور جهت انجام آزمایشات انتخاب شدند. به منظور ته‌نشین‌شدن پروتواسکولکس‌ها و باقیمانده لایه‌ها، مایع کیست جمع‌آوری شده در لوله‌های فالکون استریل50میلی‌لیتر، در دور ×g 2000 به مدت 5 دقیقه سانتریفیوژ گردید. مایع رویی در لوله‌های فالکون جدید استریل جمع‌آوری و برای انجام مطالعات بعدی در -20  درجه سانتی‌گراد نگه داری شد.‌

 به‌دست‌آوردن نمونه خون گاو غیرآلوده به کیست هیداتید: به ‌منظور بررسی بیان ژن‌های آپوپتوز  Bax، Bcl-2و Caspase 3 القا شده در لنفوسیت‌های گاو توسط مایع کیست هیداتید بارور و غیربارور، با مراجعه به کشتارگاه فساران، از ورید گردن 10 عدد گاو  با سرنگ 50 میلی‌لیتر آغشته به هپارین خونگیری انجام شد. طی مرحله کشتار و بررسی اعضا و احشای داخلی (کبد، ریه، طحال و ...) گاو، دام غیرآلوده به کیست هیداتید شناسایی و نمونه خون آن به آزمایشگاه کشت سلولی گروه انگل‌شناسی دانشکده پزشکی انتقال داده شد.

جداسازی و کشت لنفوسیت‌های گاوی: 20 میلی‌لیتر از خون کامل گاو آغشته به هپارین با ml20 بافر HBSS فاقدca2+وMg2+(8M NaCl, 0.4M KCl, 0.12M Na2Hpo4, 0.35M NaHco3, 1M D-Glucose) مخلوط و لنفوسیت‌ها با استفاده از روش Ficoll (Lymphodex, inno-train, H9L6095) با سرعت ×g1500، در دمای20-18 درجه سانتی‌گراد، به مدت 30 دقیقه سانتریفیوژ و جداسازی شد. سلول‌های به دست آمده پس از شستشو، شمارش شده و با رنگ حیاتی تریپان‌بلو از نظر زنده بودن بررسی و در پلیت‌های  5/3 سانتی‌متر حاوی محیط RPMI مغذی تقسیم شد (4).

به ‌منظور بررسی اثر سیتوتوکسیسیتی مایع کیست بر روی لنفوسیت‌ها از آزمون MTS استفاده شد. آزمون MTS یک روش رنگ سنجی است با فرمول شیمیایی که در زیر آمده است :

3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2 (4-sulfophenyl)2H-tetrazolium inner salt

این روش تعداد سلول‌های زنده را در پلیت‌های چند خانه‌ای شمارش می‌کند که بر اساس احیای رنگ توسط آنزیم ردوکتاز میتوکندری در سلول‌های زنده استوار است که با استفاده از نمک زردرنگ تترازولیوم شناسایی می‌شود. این ماده به ‌وسیله سلول‌های زنده جذب و کریستال‌های بنفش رنگ محلول فورمازان تشکیل می‌گردد. میزان این ترکیب رنگی توسط اسپکتروفتومتر خوانش می‌شود.

روش انجام MTS: تعداد 105 سلول در حجم 100 میکرولیتر محیط مغذی در هر چاهک پلیت 96 تایی ته ‌صاف تقسیم شد. به‌ منظور سازگارشدن لنفوسیت‌ها در محیط تازه، پلیت‌ها در انکوباتور 37 درجه سانتی‌گراد با 5 درصد CO2 و رطوبت 95درصد به مدت 2 ساعت نگه‌داری شدند. سپس از مایع کیست‌های بارور و غیربارور 10درصد و 15درصد به چاهک‌های مربوطه اضافه و از سلول‌های بدون تیمار با مایع کیست به ‌عنوان کنترل منفی استفاده شد. آزمایش برای هر غلظت 3 بار تکرار گردید و سلول‌ها به مدت 24 ساعت در شرایط کشت نگه‌داری شدند. پس از گذشت مدت زمان تیمار، پلیت از انکوباتور خارج و با سیتوسانتریفیوژ با سرعت ×rpm1500 به مدت 5 دقیقه سانتریفیوژ شد. مایع رویی به‌ آرامی از کنار هر چاهک به کمک سمپلر جمع‌آوری و دور ریخته شد. سپسlµ80RPMI  خالص و 20 میکرولیتر معرف MTS به هر چاهک اضافه و مخلوط شد، پلیت‌ها با فویل پوشانده و به مدت 3 ساعت در 37 درجه سانتی‌گراد انکوبه گردید. جذب نوری چاهک‌ها پس از 3 ساعت انکوباسیون با دستگاه Elisa Reader در طول موج  490 نانومتر خوانش شد (23).

بررسی بیان ژن‌های آپوپتوز به روشReal Time PCR : بررسی بیان ژن‌های آپوپتوزBax, Bcl2و Caspase 3در لنفوسیت‌های تیمار شده با مایع هیداتید بارور و غیربارور طبق مراحل زیر انجام گردید.

استخراج RNA از لنفوسیت‌های تیمار شده با مایع هیداتید کیست‌های بارور و غیربارور: cell/ تعداد 106×2 لنفوسیت به ‌دست آمده با روش فایکول، با 200میکرولیتر (10 درصد) مایع کیست‌های بارور و غیربارور تیمار شد. مراحل استخراج RNA با کیت استخراج (Jena Bioscience PP-210S) و سپس سنتز cDNA با کیت cDNA )فرمنتاز (Fermentas, #k1621 طبق دستورالعمل کیت‌ها انجام گردید.

 Real Time-PCR: توالی ژن‌های مورد نظر از سایت http://www.ncbi.nlm.nih.gov/gene گرفته و با استفاده از برنامه‌هایgene runner وOligo Analyzer طراحی پرایمر اختصاصی انجام شد. سپس با استفاده از سایت NCBI پرایمرها به منظور بررسی عدم اتصال به توالی‌های غیراختصاصیBLAST شدند. ژن GAPDH در این مطالعه به عنوان ژن مرجع و یاhousekeeping  مورد استفاده قرار گرفت (جدول 1).

برای انجام آزمایش از کیت Syber green Ampliqon, A325402)) استفاده شد. مقدار  µl10Master Mix  و  µl 5/1 cDNA و 1میکرولیتر از پرایمرهای رفت و برگشت با 5/6 میکرولیتر آب مقطر مخلوط و داخل دستگاه ترموسیکلر Real time PCR (شرکت ABI-ساخت آمریکا) قرار داده شد. در این مرحله برای هر نمونه 3 بار تکرار و از cDNA لنفوسیت‌های بدون تیمار به عنوان کنترل منفی استفاده شد. پس از انجام واکنش میزان سیکل آستانه (CT) نمونه‌ها توسط دستگاه به صورت مقادیر کمی اندازه‌گیری می‌شد. برنامه زمان‌بندی دستگاه و دماهای مربوطه در جدول 2 آمده است.

بررسی‌های آماری: آنالیز نتایج حاصل از آزمون MTS با استفاده از آزمون T تک نمونه‌ای و آنالیز نتایج حاصل از واکنش
Real-Time PCR، با استفاده از فرمول 2-ΔΔCT (9) که در زیر آمده است و نرم‌افزارهای REST (version2.0.13,2009) و SPSS (version 20) با آزمون آنالیز واریانس یک‌طرفهANOVA  انجام شد. در این مطالعه 05/0P   معنی دار تلقی گردید.

2-ΔΔCT=2-ΔCT(Treated Group) - ΔCT(Untreated Group)

ΔCT=CT Gene – CT Housekeeping Gene

 

نتایج

نتایج آزمون MTS: اولین گام در بررسی آپوپتوز بررسی سیتوتوکسیسیتی است که در این مطالعه با روش MTS میزان سیتوتوکسیسیتی مایع کیست هیداتید بارور و غیربارور بر روی لنفوسیت‌های گاو مورد ارزیابی قرار گرفت. از مقایسه داده‌های به دست آمده از سنجش درصد حیات و فعالیت متابولیکی سلول‌های لنفوسیت تیمار شده با مایع هیداتید کیست‌های بارور و غیربارور با آزمون T تک نمونه‌ای مشخص شد که تفاوت میانگین درصد حیات سلول‌ها در غلظت‌های 10درصد و 15درصد در زمان 24 ساعت در گروه تیمار با مایع کیست هیداتید بارور و غیربارور به ترتیب در سطح 001/0= P و 002/0= P نسبت به گروه کنترل معنی‌دار بود. در زمان انکوباسیون 24 ساعته درصد مرگ سلولی با افزایش غلظت مایع هیداتید بارور و غیربارور در لنفوسیت‌ها افزایش یافته است (نمودارهای 1 و 2). همچنین میانگین زیستی لنفوسیت‌ها در گروه‌های تیمارشده با مایع کیست هیداتید بارور و غیربارور نسبت به یکدیگر اختلاف معنی‌دار (05/0 >P) داشت.

نتایج تست Real time PCR : نتایج تیمار لنفوسیت‌ها با غلظت 10درصد (l/mlµ100) مایع کیست بارور و غیربارور نشان داد که بیان ژن Bax در لنفوسیت‌های تیمار شده با مایع کیست بارور نسبت به لنفوسیت‌های تیمار شده با مایع کیست غیربارور معنی‌دار (046/0P=) بود (نمودار 3-A). اگرچه بیان ژن Caspase 3 در لنفوسیت‌های تیمار شده با مایع کیست بارور در مقایسه با لنفوسیت‌های تیمار شده با مایع غیربارور بالاتر نشان داده شد ولی از نظر آماری تفاوت معنی‌داری نداشت (نمودار 3-B). همچنین گرچه افزایش بیان ژن آنتی‌آپوپتوز Bcl-2 در لنفوسیت‌های تیمار شده با مایع کیست غیربارور در مقایسه با لنفوسیت‌های تیمار شده با مایع بارور مشاهده گردید ولی تفاوت معنی‌دار نبود (نمودار3-C).

بحث


انگل‌ها دارای استراتژی‌هایی برای فرار از سیستم ایمنی میزبانمی‌باشند. مرحله لاروی کرم اکینوکوکوس گرانولوزوس نیز دارای مکانیسم‌های دفاعی پیچیده است که با فرار از پاسخ‌های ایمنی میزبان و تعدیل آن باعث بقای خود در بدن میزبان می‌شود. اخیرا آپوپتوز به‌عنوان بخش مهمی از دفاع انگل در مقابل سیستم دفاعی میزبان و تعدیل آن مورد بررسی قرار گرفته است. در مطالعات متعددی به خواص توکسینی مایع هیداتید و آپوپتوزی آن در رده‌های مختلف سلول‌های ایمنی اشاره شده است (5,11,16,24,2626). در مطالعه حاضر اثر سیتوتوکسیسیتی، آپوپتوز و سازوکار القاء آپوپتوز مایع هیداتید گاوی بر روی سلول‌های لنفوسیت به عنوان سلول‌های موثر ایمنی علیه انگل اکینوکوکوس بررسی شد.

درمطالعاتگذشتهاثر مایع هیداتید بر توانزیستیبعضیرده‌هایسلولیوالقاءآپوپتوزانجامگرفتهکهسازگار با  یافته‌هایاینپژوهشمی‌باشد. مطالعه Yin و همکاران در سال 2014 که بر روی اثر مایع هیداتید در سلول‌های طحال موش BALB/c  انجام گرفت، نشان داد که مایع هیداتید با کاهش بیان NKG2D که سیتوکین کلیدی برای تحریک سلول‌های کشنده است، اثر سیتوتوکسیسیتی سلول‌های کشنده طبیعی را کاهش می‌دهد (24). Macintyre و همکاران در سال 2000 نیز توان زیستی ماکروفاژهایp388d  تیمار شده با مایع هیداتید را با روش MTT بررسی کردند. نتایج آنها نشان داد مایع هیداتید باعث کاهش معنی‌داری در میزان زنده بودن ماکروفاژها می‌شود. آنها نتیجه گرفتند که مایع هیداتید پتانسیل کنترل رشد لنفوسیت‌ها را از طریق کاهش ماکروفاژها نیز دارد. همچنین آپوپتوز سلول‌های ماکروفاژ میزبان در اطراف کیست هیداتید کرم اکینوکوکوس گرانولوزوس توسط انگل مشاهده شده است (11). در مطالعه‌ی حاضر نیز نتایج MTS  نشان داد که درصد حیات و فعالیت متابولیکی سلول‌های لنفوسیت تیمار شده با مایع هیداتید کیست‌های بارور و غیربارور نسبت به گروه کنترل در سطح معنی‌داری کاهش یافته است. همچنین میانگین زیستی لنفوسیت‌ها در گروه‌های تیمارشده با مایع کیست هیداتید بارور و غیربارور نسبت به یکدیگر اختلاف معنی‌دار (05/0 >P) داشت.

یافته‌های مطالعه‌ی حاضر و مطالعات فوق‌الذکر نشان می‌دهد که سیستم کشت یک ارزیابی ساده از اثر سیتوتوکسیسیتی از مایع هیداتید را فراهم می‌کند. بعلاوه، به نظر می‌رسد که در مایع هیداتید مولکول‌هایی وجود دارد که سبب مهار سلول‌های ایمنی می‌شود. ممکن است این مولکول‌ها که توسط انگل ایجاد شده است به تدریج به نواحی اطراف کیست آزاد شده و سبب مهار و مرگ سلول های ایمنی مانند ماکروفاژها، لنفوسیت‌ها و سلول‌های کشنده طبیعیمیزبان ‌شود که احتمالا می‌تواند توصیفی برای فرار انگل از کنترل ایمنولوژیکی میزبان خود باشد (11,24).

برای تعیین سازوکار آپوپتوز میانگین بیان ژن پروآپوپتوز Bax و ژن آنتی آپوپتوز Bcl-2 و آنزیم Caspase 3که نقش کلیدی در مکانیسم آپوپتوز را دارند، اندازه گیری شده است. نتایج نشان داد که بیان ژن Bax به طور معنی‌دار (05/0 >P) و بیان Caspase 3 در لنفوسیت‌های تیمار شده با مایع کیست هیداتید بارور در مقایسه با لنفوسیت‌های تیمار شده با مایع غیربارور و گروه کنترل بالاتر بوده است. با توجه به اینکهیکی از محرک‌های فعال‌کننده مسیر داخلی توکسین‌ها می‌باشند، به نظر می‌رسد که مایع کیست هیداتید با اثر توکسینی خود از طریق مسیر میتوکندریال سبب القای آپوپتوز در لنفوسیت‌ها شده است. افزایش بیان ژن Bax و کاهش بیان ژن آنتی آپوپتوز Bcl-2 با تغییر و نفوذپذیری غشای میتوکندری و به دنبال آن فعال‌کردن آبشار کاسپازی و افزایش بیان Caspase 3 سبب آپوپتوز سلول‌های لنفوسیتی شده است. قابل ذکر است که بیان ژن‌های پروآپوپتوتیک Baxو Caspase 3 در لنفوسیت‌های تیمار شده با مایع هیداتید بارور نسبت به غیربارور و کنترل بیشتر است. از طرف دیگر بیان ژن آنتی‌آپوپتوتیک Bcl-2در این گروه در مقایسه با لنفوسیت های تیمار شده با مایع هیداتید غیربارور و کنترل کمتر  است. یافته‌های مطالعه حاضر با نتایج پژوهش Mokhtari و همکاران در سال 2011 که بیان این ژن‌ها را  در لنفوسیت‌های تیمارشده با مایع‌ کیست هیداتید انسان به روش نیمه کمی RT-PCR اندازه‌گیری کرده بودند، هم‌خوانی دارد (15). در مطالعه‌ای دیگر فعالیت میتوزی و تغییرات غشا لنفوسیت‌های تحت تاثیر غلظت‌های مختلف مایع هیداتید در محیط کشت بررسی شد. نتایج حاکی از اثرات سیتوتوکسیسیتی مایع هیداتید در کاهش فعالیت فازS  سلولی بود، که با تغییرات در غشا لنفوسیت‌ها همراه بود. نتایج پژوهش آن‌ها، افزایش CD38 وCD25 و کاهش CD28 را بر سطح Tcell ها نشان داد که می‌تواند نمایانگر آپوپتوزیا عدم پاسخ Tcell ها در اثر مایع هیداتید باشد. همچنین نتایج آن‌ها نشان داد که مایع هیداتید غیربارور اثر مهاری کمتری از مایع هیداتید بارور دارد (13)، نتایج پزوهش حاضر هم نشان می دهد مایع هیداتید غیربارور اثر سیتوتوکسیسیتی و همچنین اثر آپوپتوزی کمتری از مایع هیداتید بارور دارد. این نتیجه که مایع کیست غیربارور نیز سبب کاهش توان زیستی لنفوسیت‌ها و آپوپتوز آنها شده نمی‌تواند ثابت کند که باروری شرط لازم برای اثر توکسینی یا آپوپتوزی مایع هیداتید باشد ولی می‌تواند نشان دهد که پتانسیل تعادل و تعدیل سیستم ایمنی میزبان توسط ترشحات یک کیست هیداتید ویژگی محیط داخلی انگل است که ممکن است پاسخ علیه میزبان را سازمان‌دهی کند. از طرف دیگر، نتایج نشان می‌دهد که توان زیستی و فعالیت متابولیتی در لنفوسیت تیمار شده با مایع هیداتید غیربارور بیشتر و القا آپوپتوز کمتر بوده است. به نظر می‌رسد که مولکول‌های موجود در دو نوع کیست متفاوت می‌باشند، احتمالا آنتی‌ژن های ترشح شده از پروتواسکو-لکس‌های موجود در کیست‌های بارور سبب القای بیشتر آپوپتوز در لنفوسیت‌های میزبان گردیده است. همچنین، پژوهش‌های مختلف نشان داده که مایع کیست هیداتید و پروتواسکولکس‌ها بر کاهش رشد سلول‌های توموری از راه افزایش مرگ سلولی و مهارتکثیرT-cell ها نیز اثر دارد (2,12,25).

این بررسی‌ها تعیین می‌کندکهمولکول‌های مایع کیست هیداتید و پروتواسکولکس‌ها قادر به ایجاد آپوپتوز در سلول‌های ایمنی میزبان بوده، بنابراین یکی از دلایل بقای انگل اکینوکوکوس گرانولوزوس در بدن میزبان واسط وجود پروتئین‌های ضروری در مایع کیست است. در واقع مایع کیست هیداتید در تنظیم پاسخ ایمنی ذاتی میزبان علیه انگل دخالت دارد. مایع هیداتید مخلوط پیچیده‌ای ازترکیبات مشتق از میزبان و ترکیبات مشتق از فعالیت متابولیکی انگل می‌باشد (19). بنابراین باید مطالعات بیشتری بر روی شناسایی مواد و مولکول‌های موجود در کیست‌های بارور و غیربارور در میزبان‌های مختلف انجام شود.

نتیجه‌گیری نهایی: یافته‌های این مطالعه نشان داد که مایع هیداتید می‌تواند باعث کاهش توان زیستی و فعالیت متابولیتی لنفوسیت‌ها و همچنین با افزایش بیان ژن Bax و آنزیم Caspase 3 و کاهش بیان ژن آنتی آپوپتوز Bcl-2سبب القا آپوپتوز در این سلول‌ها شود. شناسایی و آنالیز ترکیبات مایع هیداتید به‌ عنوان مسئول القای آپوپتوز ممکن است در روشن ‌شدن این مطلب که چگونه این انگل می‌تواند پاسخ ایمنی میزبان را به نفع خود کنترل و تعدیل کند، کمک کننده باشد که البته نیاز به مطالعات بیشتری در این زمینه می باشد.

سپاسگزاری

این مقاله برگرفته از پایان‌نامه کارشناسی ارشد رشته انگل‌شناسی به شماره 394906 است که با همکاری دانشگاه علوم پزشکی اصفهان انجام شده است. از همکاری معاونت پژوهشی و مسئولان بخش انگل‌شناسی دانشگاه علوم پزشکی و کشتارگاه فساران اصفهان قدردانی می‌شود.

تعارض منافع

بین نویسندگان تعارض در منافع گزارش نشده است.

 

جدول 1. پرایمرهای طراحی شده

نام ژن

ترادف رفت

ترادف برگشت

طول

Bax

TTTGCTTCAGGGTTTCATCC

CAGTTGAAGTTGCCGTCAGA

bp 174

BCL2

GTCATGTGTGTGGAGAGCGTC

TCCACAAAGGCGTCCCAG

bp 134

CASP3

AGAACTGGACTGTGGTATTGAGAC

TCGCCAGGAAAAGTAACCAG

bp 124

GAPDH

TCGGAGTGAACGGATTCG

CATGTAGTGAAGGTCAATGAAGG

bp 113

جدول 2. زمان و دماهای مربوط به واکنش Real time PCR

مرحله

زمان

دما

تعداد سیکل

واسرشتگی اولیه

10 دقیقه

95

1

واسرشتگی

15 ثانیه

95

40

اتصال و گسترش نهایی

60 ثانیه

60

40

نمودار 1. مقایسه درصد حیات (میانگین ± انحراف معیار)  لنفوسیت‌های تیمار شده با مایع هیداتیک به تفکیک غلظت در گروه بارور با گروه کنترل (100%)

نمودار 2. مقایسه درصد حیات (میانگین ± انحراف معیار) لنفوسیت‌های تیمار شده با مایع هیداتیک به  تفکیک غلظت در گروه غیربارور با گروه کنترل (100درصد) ***: 002/0P =

نمودار 3. A مقایسه میانگین بیان ژن Bax در لنفوسیت‌های تیمار شده با مایع کیست بارور و غیربارور وگروه کنترل. B مقایسه میانگین بیان ژن Caspase 3در لنفوسیت‌های تیمار شده با مایع کیست بارور و غیربارور و گروه کنترل. C مقایسه میانگین بیان ژن Bcl-2 در لنفوسیت‌های تیمار شده با مایع کیست بارور و غیربارور و گروه کنترل. *:05/0 >P

  1. Adinehbeigi, K., Radfar, M.H., Rahmani, K. (2013). The role of cattle in the epidemiology of   Echinococcus granulosus in Kerman area, southeast of Iran. Comparative Clinical Pathology, 22, 233-8.
  2. Aref, N., Shirzad, H., Yousefi, M., Darani, H. (2012). Effect of Different Hydatid Cyst Molecules on Hela and Vero Cell Lines Growth In vitro. J Immunodefic Disor, 2, 1. http://dx.doi.org/10. 4172/2324-853X.1000105
  3. Bienvenu, A.L.,Gonzalez-Rey,E., Picot, S. (2010). Apoptosis induced by parasitic diseases. Parasites and Vectors, 3, 106.
  4. Bruschke, C., Hulst, M.M., Moormann, R., Van Rijn, P., Van Oirschot, J. (1997). Glycoprotein Erns of pestiviruses induces apoptosis in lymphocytes of several species. Journal of virology, 71, 6692-6.
  5. Cabrera, G., Cabrejos, M.E., Morassutti, A.L., Cabezón, C., Orellana, J., Hellman, U., Zaha, A., Galanti, N. (2008). DNA damage, RAD9 and fertility/infertility of Echinococcus granulosus hydatid cysts. Journal of cellular physiology, 216, 498-506. http://doi..org/10.1002/jcp.21418
  6. Eckert, J., Deplazes, P. (2004). Biological, epidemiological, and clinical aspects of echinococcosis, a zoonosis of increasing concern. Clinical microbiology reviews, 17, 107-135.
  7. Elmore, S. (2007). Apoptosis: a review of programmed cell death. Toxicologic pathology, 35, 495-516. https://doi.org/10. 1080/01926230701320337
  8.  Farias-de-Oliveira, D.A., Villa-Verde, D.M.S., Panzenhagen, P.H.N.,  Santos, D.S.D., Berbert, L.R., Savino, W., Meis, J.D. (2013). Caspase-8 and caspase-9 mediate thymocyte apoptosis in Trypanosoma cruzi acutely infected mice. Journal of leukocyte biology, 93, 227-34. https://doi.org/10.1189/ jlb.1211589
  9. Faridnia, R., Tolouei, S., Khanahmad-Shahreza, H., Kalani, H., Yousefi-Darani, H. (2015). Evaluating the gene expression level of IL-12 in the fibrous layer of hepatic hydatid cysts isolated from slaughtered animals. Comparative Clinical Pathology, 24, 1193-6.
  10. Haniloo, A., Ghasemi, F., Shikhi, A., Ghavami, M. (2008). Immunoregulatory cytokine (TGF-ß And IL-10) responses in mice inoculated with protoscoleces and major hydatid fluid antigens of cystic echinococcosis. Iranian Journal of Parasitology, 3, 18-23.
  11. Macintyre, A.R., Dixon, J.B., Green, J.R. (2000). Growth kinetics of leukocyte cell lines cultured with hydatid fluid of Echinococcus granulosus equinus. Parasite immunology, 22, 651-7. https://doi.org/10.1046/j.1365-3024.2000.00350.x
  12. Macintyre, A.R., Dixon, J.B. (2001). Echinococcus granulosus: regulation of leukocyte growth by living protoscoleces from horses, sheep, and cattle. Experimental parasitology, 99, 198-205. https://doi.org/10.1006/expr.2001.4662
  13. Macintyre, A.R., Dixon, J.B., Green, J.R. (2001). Mitosis and differentiation in T-cells under cytotoxic action of Echinococcus granulosus hydatid fluid. Veterinary parasitology, 96, 277-89. https://doi.org/10.1016/S0304-401 7(01)00384-3
  14. Mejri, N., Müller, N., Hemphill, A., Gottstein, B. (2011). Intraperitoneal Echinococcus multilocularis infection in mice modulates peritoneal CD4+ and CD8+ regulatory T cell development.Parasitologyinternational,60,45-53. https://doi.org/10.1016/j.parint.2010.10.002
  15. Mokhtari Amirmajdi, M., Sankian, M., Eftekharzadeh Mashhadi, I., Varasteh, A., Vahedi, F.,Sadrizadeh, A., Spotin, A. ( 2011). Apoptosis of human lymphocytes after exposure to hydatid fluid. Iranian journal of parasitology, 6, 9-16.
    PMID: 22347282
  16. Rigano, R., Profumo, E., Bruschi, F., Carulli, G., Azzara, A., Ioppolo, S., Buttari, B., Ortona, E., Margutti, P., Teggi, A., Siracusano, A. (2001). Modulation of human immune response by Echinococcus granulosus antigen B and its possible role in evading host defenses. Infection and Immunity, 69, 288-96. https://doi.org//10.1128/ IAI.69.1.288296.2001
  17. Sadjjadi, S.M. (2006). Present situation of echinococcosis in the Middle East and Arabic North Africa. Parasitology international, 55, 197-202 https://doi.org/10.1016/j.parint.2005.11.030.
  18. Serradell, M.C., Guasconi, L., Cervi, L., Chiapello, L.S., Masih, D.T. (2007). Excretory-secretory products from Fasciola hepatica induce eosinophil apoptosis by a caspase-dependent mechanism. Veterinary immunology and immunopathology, 117, 197-208. https://doi.org/10.1016/ j.vetimm.2007.03.007
  19. Shepherd, J.C., Aitken, A., McManus, D.P. (1991). A protein secreted in vivo by Echinococcus granulosus inhibits elastase activity and neutrophil chemotaxis. Molecular and biochemical parasitology, 44, 81-90. https://doi.org/10.1016/0166-6851 (91)90223-S
  20. Siracusano, A., Margutti, P., Delunardo, F., Profumo, E., Riganò, R., Buttari, B., Teggim A., Ortona, E. (2008). Molecular cross-talk in host–parasite relationships: the intriguing immunomodulatory role of Echinococcus antigen B in cystic echinococcosis. International journal for parasitology, 38, 1371-6. https://doi.org/10.1016/j.ijpara.2008.06.003
  21. Spotin, A., Mokhtari Amirmajdi, M., Sankian, M., Varasteh, A. (2012). The study of apoptotic bifunctional effects in relationship between host and parasite in cystic echinococcosis: a new approach to suppression and survival of hydatid cyst. Parasitology research, 110, 1979-84. https://doi.org/10.1007 /s00436-011-2726-4
  22. Tato, P., Fernandez, A., Solano, S., Borgonio, V., Garrido, E., Sepulveda, J.,  Molinari, J.L. (2004). A cysteine protease from Taenia solium metacestodes induce apoptosis in human CD4+ T-cells. Parasitology research,92, 197-204. https://doi,org/ 10.1007/s00436-003-1008-1
  23. Wang, B., Shravah, J., Luo, H., Raedschelders, K., Chen, D.D., Ansley, D.M. (2009). Propofol protects against hydrogen peroxide-induced injury in cardiac H9c2 cells via Akt activation and Bcl-2 up-regulation. Biochemical and biophysical research communications, 389, 105-11. https://doi.org/10.1016/ j.bbrc.2009.08.097
  24. Yin, S., Chen, X., Zhang, J., Xu, F., Hou, J., Wu, X., Chen, X. (2014). Initial Studies on the Role of Hydatid Fluid in the Immune Evasion Strategies of Echinococcus granulosus. Pakistan J Zool, 46, 1711-8.
  25.  Yousofi Darani, H., Soozangar, N., Khorami, S., Taji, F., Yousofi, M., Shirzad, H. (2012). Hydatid cyst protoscolices induce cell death in WEHI-164 fibrosarcoma cells and inhibit the proliferation of baby hamster kidney fibroblasts in vitro. Journal of parasitology research, 2012, 1-4. http://dx.doi.org/1 0.1155/2012/304183
  26. Zeghir-Bouteldja, R., Amri, M., Bouaziz, S., Mezioug, D., Touil-Boukoffa, C. (2013). Comparative study of nitric oxide (NO) production during human hydatidosis: relationship with cystic fluid fertility. Parasitology research, 112, 649-54. http://doi,org/10.1007/s00436-012-3181-6