مطالعة شجره‌شناسی دو جدایة ویروس بیماری نیوکاسل (NDV) به دست آمده از گله های طیور استان اصفهان در سال 1377 بر اساس تعیین توالی ژن هماگلوتینین-نورآمینیداز (HN)

نوع مقاله: بهداشت و بیماری های پرندگان

نویسندگان

1 گروه بیماری‌های طیور، دانشکده دامپزشکی دانشگاه تهران، تهران، ایران

2 گروه تحقیقات و تشخیص بیماری‌های طیور، موسسة تحقیقات واکسن و سرم‌سازی رازی، البرز، حصارک، ایران

چکیده

زمینۀ مطالعه: ویروس‌های بیماری‌زای بیماری نیوکاسل (vNDV) در کشور ما و در سراسر دنیا خسارات اقتصادی چشم‌گیری را بر صنعت پرورش طیور تحمیل می‌کنند. با این‌حال، مطالعات پراکنده و به نسبت اندکی در رابطه با تعیین هویت این ویروس‌ها در کشور ما انجام گرفته است.
هدف: مطالعة حاضر با هدف تعیین هویت دو جدایه ویروس‌ بیماری نیوکاسل (NDV) بدست آمده از گله های طیور در استان اصفهان از طریق تعیین توالی کامل ژن هماگلوتینین-نورآمینیداز (HN) صورت پذیرفته است.
روش‌کار: ژن HN هر کدام یک از دو جدایه‌ NDV به کمک پرایمرهای اختصاصی تکثیر، تعیین توالی و مورد تجزیه و تحلیل شجره‌شناسی قرار گرفت.
نتایج:  ارزیابی‌های شجره‌شناسی بر اساس توالی کامل ناحیة کد شوندة ژن HN جدایه‌های NDV مورد بررسی را در تیپ ژنومی XIII و تحت تیپ XIIIa طبقه‌بندی کرد. این نتایج با نتایج حاصل از تحلیل توالی ناکامل ژن  فیوژن (F) در این ویروس‌ها، که از بانک ژن اخذ شد؛ همخوانی داشت.
نتیجه‌گیری نهایی: نتایج این مطالعه در راستای شناخت بیشتر همه‌گیرشناسی ملکولی جدایه های بومی NDV در ایران و تعیین تفاوت‌های موجود بین سویه‌های بومی و سویه‌های واکسینال متداول در سطح پروتئین‌های ایمنی‌زای اصلی مفید می‌باشد.

کلیدواژه‌ها


عنوان مقاله [English]

Phylogenetic Study of Two Newcastle Disease Virus (NDV) Isolates Obtained From Poultry Flocks in Isfahan Province in 1999 Based on Haemagglutinin-Neuraminidase (HN) Gene Sequencing

نویسندگان [English]

  • Mohammad Soltani 1
  • Seyed Mostafa Peighambari 1
  • Seyed Ali Pourbakhsh 2
  • Abbas Ashtari 2
  • Ariya Rezaei Far 1
  • Mohammad Abdoshah 2
1 Department of Avian Diseases, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran
2 Department of Avian Diseases Research and Diagnosis, Razi, Alborz, Iran
چکیده [English]

BACKGROUND: Virulent Newcastle disease virus (vNDV) imposes significant economic losses to the commercial poultry industry in our country and worldwide. However, in Iran scattered and relatively few studies have been done in order to characterize NDV isolates.  
OBJECTIVES: The aim of the present study was to characterize two vNDV isolates obtained from commercial poultry farms in Isfahan province in 1999 through Haemagglutinin-Neuraminidase (HN) gene complete sequencing.
METHODS: Haemagglutinin-Neuraminidase (HN) gene of each NDV isolate was amplified and sequenced using specific primers and then phylogenetically analyzed.
RESULTS: Based on complete coding sequence of HN gene analysis, studied isolates showed close relationship with genotype XIII and subgenotype XIIIa NDV strains. Analysis of both complete HN gene and partial F gene lead to identical results and same classification of studied viruses.
CONCLUSIONS: Results of present study are useful  for a better understanding of molecular epidemiology of indigenous NDV strains and determining important molecular differences between field and commonly used vaccinal strains related to main immunogenic proteins.

کلیدواژه‌ها [English]

  • Newcastle disease virus (NDV)
  • Virulent
  • Haemagglutinin-Neuraminidase (HN)
  • Phylogenetic study
  • Poultry

مقدمه

 

بیماری نیوکاسل (ND) یک بیماری بسیار کشنده و مسری است که طیف وسیعی از گونه‌های پرندگان را تحت تأثیر قرار می‌دهد و به‌وسیلة ویروس بیماری نیوکاسل (NDV) یا تیپ 1 پارامیکسوویروس‌های پرندگان (APMV1) ایجاد می‌شود (1،23). این بیماری به‌دلیل برخورداری از شیوع جهانی و دخالت طیف وسیعی از پرندگان اهلی و وحشی در همه‌گیرشناسی آن، به‌عنوان یکی از زیان‌بارترین بیماری‌ها در راستای محدود سازی توسعة صنعت طیور تجاری محسوب می‌گردد (23). ویروس بیماری نیوکاسل یک ویروس غشادار است که از نظر تاکسونومیک در جنس آوولاویروس، خانوادة پارامیکسوویریده و راستة مونونگاویرالس طبقه‌بندی می‌شود (20،21). ژنوم ویروسی NDV دارای سنس منفی، تک قطعه‌ای، تک رشته‌ای و از جنس ریبونوکلئیک اسید است و 6 پروتئین ساختاری را کُد می‌کند. در بین این پروتئین‌ها تنها پروتئین‌های فیوژن (F)، هماگلوتینین-نورآمینیداز (HN) و ماتریکس (M) با غشای ویروسی در تعامل هستند و بروز ویژگی‌های اصلی پادگنی و بیماریزایی ویروس را بر عهده دارند (15). در این بین گلیکوپروتئین HN در طول فرایند عفونت‌زایی و بیماری‌زایی ویروس عملکردهای متعددی را از قبیل هماگلوتیناسیون (HA)، نورآمینیداز (NA) و تسهیل الحاق غشایی بر عهده دارد و به‌عنوان تعیین کنندة پادگنی اصلی پارامیکسوویروس‌ها شناخته می‌شود (18).

بر اساس تفاوت‌های ژنی و شجره‌شناسی، ویروس‌های عامل بیماری نیوکاسل در دو کلاس مختلف (I و II) قرار می‌گیرند. این طبقه‌بندی به‌شکل استاندارد با تحلیل توالی کامل ناحیة کد شوندة ژن F صورت می‌پذیرد، و بر همین اساس سویه‌های متعلق به کلاس I در یک تیپ ژنی و سویه‌های موجود در کلاس II در 18 تیپ ژنی و تعداد زیادی تحت ژنوتیپ مختلف طبقه‌بندی می‌شوند (6،36).

سویه‌های ویروس بیماری نیوکاسل طیف وسیعی از بیماری‌زایی را در پرندگان تحت تأثیر نشان می‌دهند؛ از این‌رو این ویروس‌ها در 4 تیپ بیماری‌زای اصلی شامل غیربیماری‌زا (بی‌نشانة روده‌ای)، با بیماری‌زایی کم (لنتوژن)، با بیماری‌زایی متوسط (مزوژن) و بیماری‌زا (ولوژن) طبقه‌بندی می‌شوند. آزمون‌های بیماری‌زایی درون‌تن (in vivo) از قبیل متوسط زمان مرگ (MDT) و شاخص بیماری‌زایی داخل مغزی (ICPI) به‌شکل متداول و مرسوم به‌منظور تعیین تیپ بیماری‌زایی جدایه‌های NDV مورد استفاده قرار می‌گیرند. به‌علاوه، تعیین تیپ بیماری‌زایی جدایه‌های NDV از مسیر پیش‌بینی توالی محل شکاف گلیکوپروتئین F (FGCS) نیز به‌شکل ملکولی امکان‌پذیر است، به‌نحوی‌که حضور آمینو اسیدهای بازی متعدد در این ناحیه بیان‌گر بیماری‌زا بودن ویروس خواهد بود (28). با این‌حال، برخی از سویه‌هایی که در FGCS توالی بیماری‌زا داشته‌اند در آزمون‌های بیماری‌زایی درون تن توان بیماری‌زایی اَندکی نشان داده‌اند. و ظاهراً FGCS تنها عامل دخیل در بروز خصوصیات بیماری‌زایی ویروس نیست. بنابراین، دیگر نواحی ژنوم NDV به‌ویژه ژن HN نیز باید در بروز کامل توان بیماری‌زایی ویروس دخالت داشته باشند (7). با وجود نقش برجستة گلیکوپروتئین HN در بیماری‌زایی و القای پاسخ‌های ایمنی میزبان به‌وسیلة NDV، در نشریات داده‌های محدودی در رابطه با خصوصیات ملکولی این گلیکوپروتئین و ژن کد کنندة آن وجود دارد و در کشور ما نیز اطلاعات اندکی در این زمینه انتشار یافته است (9،10).

از سال 1330 (1951 میلادی)، پس از اولین گزارش مستند بیماری نیوکاسل در کشور ما تاکنون، وقوع واگیری‌های بیماری در گونه‌های مختلف پرندگان از جمله طیور تجاری، پرندگان وحشی و پرندگان همراه تداوم داشته است (2،30). در حال حاضر نیز بیماری نیوکاسل به‌شکل بومی یا اندمیک در کشور ما حضور دارد و با وجود واکسیناسیون گستردة گله‌های طیور تجاری با انواع واکسن‌های فعال و غیرفعال، واگیری‌های بیماری با شدت‌های مختلف، به‌صورت متداول و به‌شکل مداوم در سراسر ایران گزارش می‌گردند؛ با این وجود، اطلاعات اندکی در ارتباط با همه‌گیرشناسی و خصویات ملکولی جدایه‌های بومی NDV در ایران وجود دارد. در این مطالعه، تعیین هویت ملکولی دو جدایة NDV که در سال 1377 در قالب یک طرح پایش ملی از گله‌های طیور تجاری استان اصفهان جداسازی شده بودند از مسیر تعیین توالی ژن HN انجام پذیرفت. در گذشته تعیین هویت این جدایه‌ها از طریق تعیین توالی ناکامل ژن F و تعیین شاخص‌های بیماری‌زایی درون تن صورت گرفته بود (داده‌های غیر انتشار یافته)، و در مخزن موسسة تحقیقات واکسن و سرم‌سازی رازی نگهداری می‌شدند. در مطالعة حاضر، توالی کامل ناحیة کد شوندة ژن HN در این جدایه‌ها به‌منظور فراهم‌سازی داده‌هایی در راستای شناخت ماهیت و همه‌گیرشناسی ملکولی جدایه‌های بومی‌ NDV در ایران، تعیین شد. تعیین هویت جدایه‌های بومی NDV به‌ویژه در مناطقی که در گذشته کمتر مورد ارزیابی قرار گرفته‌اند، در راستای رفع کمبودهای موجود در این زمینه و شناخت ارتباطات همه‌گیرشناختی این جدایه‌ها با جدایه‌های متعلق به کشورهای همسایه یا دیگر کشورهایی که با ما دارای تعاملات تجاری هستند از اهمیت فراوانی برخوردار است.

مواد و روش­ کار

ویروس‌های مورد مطالعه: جدایه‌های مورد بررسی در مطالعة حاضر به‌وسیلة موسسة تحقیقات واکسن و سرم‌سازی رازی فراهم گردیدند (حصارک، البرز، ایران). دو جدایة NDV مورد مطالعه در قالب یک طرح پایش ملی از مزارع پرورش تجاری طیور استان اصفهان در سال 1377 (1999 میلادی) جداسازی شده بودند. جداسازی این جدایه‌ها از گله‌های ماکیان تجاری گوشتی پس از مشاهدة علائمی از قبیل بی‌حالی، بی‌اشتهایی، دیسترس شدید تنفسی، سُرفه، تورم و اِدِم شدید صورت و نواحی اطراف حدقه‌ای، لرزش و پیچش گردن، فلجی بال و پا و اسهال سبز رنگ صورت گرفته بود. نمونه‌گیری از بافت مغز پس از مشاهدة جراحات کالبدگشایی برجستة بیماری نیوکاسل از جمله خونریزی در کانون‌های لنفاوی مجاری گوارش به‌منظور جداسازی ویروس انجام شده بود. گله‌های که ویروس ازآنها جداسازی شده بود؛ واکسن B1 را در سن 10-7 روزگی به‌عنوان پرایمر و واکسن لاسوتا را دو هفته پس از آن به‌عنوان بوستر دریافت کرده بودند. جداسازی ویروس‌ها طبق استانداردهای تعیین شده به‌وسیلة سازمان جهانی بهداشت دام (OIE) و از طریق تلقیح 200 میکرولیتر از سوسپانسیون بافتی به حفرة آلانتوئیک 5 عدد تخم مرغ جنین‌دار عاری از اجرام بیماری‌زای خاص (SPF) (LOHMANN VALO SPF®) در سن 10-9 روزگی انجام گرفت (28). به‌نحوی‌که، تخم مرغ‌های تلقیح شده در دمای 37 درجة ساتی‌گراد انکوبه و به مدت 7 روز پایش شدند. مایعات آلانتوئیک مربوط به نمونه‌هایی که مرگ جنین را پس از 7-4 روز سبب شده بودند استخراج می‌شد و با آزمون هماگلوتیناسیون (HA) برای ارزیابی فعالیت HA آزمایش می‌شد. در ادامه، نمونه‌های دارای فعالیت HA از طریق انجام آزمون ممانعت از هماگلوتیناسیون (HI) با آنتی سرم اختصاصی به عنوان تیپ 1 پارامیکوویروس‌ها تعیین هویت شدند.

استخراج RNA، واکنش رونوشت برداری معکوس (RT) و واکنش زنجیره‌ای پلیمراز (PCR): استخراج RNA از مایعات آلانتوئیک مثبت در آزمون HI به کمک کیت تجاری High pure viral RNA isolation kit (Roche molecular biomedicals, Mannheim, Germany) طبق پروتکل تعیین شده به‌وسیلة تولید کننده انجام شد. سنتز cDNA از RNA استخراج شده نیز به کمک پرایمرهای هگزامر رندوم و با استفاده از کیت تجاری RevertAid® reverse transcriptase kit (Fermentas-Thermo Fisher Scientific, Burlington, ON, Canada) صورت گرفت. برای تکثیر ناحیة کد شوندة ژن HN به صورت کامل، 3 جفت پرایمر دارای همپوشانی با استفاده از توالی‌های ثبت شده در مرکز ملی اطلاعات بیوتکنولوژی (NCBI) طراحی شد (شمارة دسترسی سویة مورد استفاده به‌عنوان الگو در طراحی پرایمر: KF727980). سنتز این پرایمرها نیز به‌وسیلة شرکت سیناژن (تهران، ایران) انجام پذیرفت. توالی و دیگر خصوصیات این پرایمرها در جدول 2 ذکر گردیده است. واکنش زنجیره‌ای پلیمراز برای تکثیر ژن HN در ترموسایکلر Peqstar 2X®, Peqlab انجام گرفت. تمامی دیگر مواد مورد استفاده به غیر از مواردی که ذکر شد از شرکت سیناژن (تهران، ایران) تهیه شدند.

ارزیابی توالی‌ها و تحلیل شجره‌شناسی: خالص‌سازی محصولات PCR به کمک کیت تجاری AccuPrep® DNA Gel Purification Kit  (Bioneer, Korea) طبق توصیة سازنده انجام شد؛ و برای تعیین توالی از دو جهت به کمک پرایمرهایی مشابه با پرایمرهای مورد استفاده در PCR به شرکت Bioneer ارسال گردیدند. هم‌ردیف‌سازی توالی‌های حاصل به کمک نرم افزارهای BioEdit (ver. 7.0.9.0) (13) و DNASIS MAX 3.0 (Hitachi Solutions America) در کنار توالی‌های انتخاب شده از بانک ژن از جمله توالی‌های مربوط به نمایندگان ویروسی ژنوتیپ‌ها و تحت ژنوتیپ‌های مختلف NDV (6) و تعدادی از توالی‌های مربوط به جدایه‌های تعیین هویت شده در سال‌های اخیر و دارای شباهت با ویروس‌ها مورد مطالعه (19،25) انجام گرفت. توالی ناکامل ژن F نیز در مورد جدایه‌های مورد مطالعه (NR15 و NR16) در کنار تعدادی دیگر از توالی‌های متناظر از بانک ژن برای انجام تحلیل شجره‌شناسی بیشتر اخذ شد. درخت‌های شجره‌شناسی بر اساس توالی‌های ژن HN و F به‌صورت جداگانه با روش maximum likelihood طبق مدل Tamura-Nei و با استفاده از نرم افزار Mega 7 رسم گردیدند (17،37). تخمین فواصل تکاملی (Evolutionary Distance) و تعیین درصد شباهت نوکلئوتیدی بین جدایه‌های مورد بررسی از مسیر Pairwise Sequence Comparison در نرم افزار Mega 7 و تحلیل داده‌های حاصل در نرم افزار اکسل انجام شد. تخمین توالی‌های آمینو اسیدی و هم‌ردیفی آنها نیز در نرم افزار Mega 7 صورت گرفت. توالی‌های مربوط به جدایه‌های تعیین هویت شده در مطالعة حاضر در بانک ژن موجود هستند و کُد دسترسی آنها در جدول 1 ذکر گردیده است.

نتایج

حدود 1980 باز از توالی ژن HN در هر یک از دو جدایة مورد بررسی در مطالعة حاضر تعیین و مورد تحلیل قرار گرفت. سیگنال آغاز رونویسی یا توالی آغازین ژن در هر دو جدایه یکسان بود و به‌صورت ACGGGTAGAA تعیین شد. کودون‌های آغاز (ATG، نوکلئوتیدهای 94-92) و پایان (TAA، 1807-1805) ترجمه در ژن HN هر دو جدایه در جایگاه‌های یکسانی قرار داشتند. محتوی گوانین و سیتوزین ژن HN در جدایه‌های NR15 و NR16 به ترتیب 46درصد و 9/45درصد تعیین شد. طول توالی آمینو اسیدی گلیکوپروتئین HN در جدایه‌های مورد مطالعه بر اساس محل قرارگیری کودون‌های آغاز و پایان ترجمه در ژن HN، 571 اسید آمینه پیش‌بینی شد؛ که با طول این گلیکوپروتئین در سویه‌های بیماریزای NDV همخوانی داشت. توالی آمینو اسیدی FGCS نیز پس از تحلیل توالی‌های ژن F اخذ شده از بانک ژن در هر دو جدایة مورد بررسی به‌شکل 112RRQRRF117 پیش‌بینی شد؛ که همانند FGCS در سویه‌های بیماری‌زای NDV بود؛ و با دیگر شاخص ملکولی بیماری‌زا بودن این جدایه‌ها یعنی طول توالی آمینو اسیدی گلیکوپروتئین HN همخوانی داشت.

توالی کامل ناحیة کد شوندة ژن HN (1716 باز) با توالی نواحی متناظر از نمایندگان ویروسی هر یک از ژنوتیپ‌های شناخته شدة NDV از جمله سویه‌های متداول واکسینال در ایران (Lasota، B1 و PHY-LMV42)، به‌منظور انجام ارزیابی‌های شجره‌شناسی مورد مقایسه و تحلیل قرار گرفت. هر دو جدایة مورد بررسی در مطالعة حاضر پس از بررسی‌های شجره‌شناسی ارتباط بسیار نزدیکی با جدایه‌های شناخته شدة تیپ ژنی XIII و تحت تیپ XIIIa نشان دادند. پس از تحلیل توالی ژن HN در ناحیة کُد شونده، NR15 و NR16 (جدایه‌های مورد بررسی در مطالعة حاضر) در بین توالی‌های موجود در بانک ژن بیشترین شباهت را درسطح نوکلئوتیدی با جدایة Sweden 97 (GU585905) به ترتیب به میزان 99 و 5/98درصد نشان دادند. در بین جدایه‌های NDV جداسازی شده در داخل کشور نیز NR15 و NR16 بیشترین شباهت نوکلئوتیدی را به ترتیب با جدایه‌های NR35 (6/99درصد) و NR14 (100درصد) نشان دادند. جدایه‌های NR35 (کد دسترسی: KX058524) و NR14 (کد دسترسی: KX034119) به‌ترتیب در سال‌های 1378 و 1377 در استان‌های فارس و اصفهان جداسازی شده بودند. جدایه‌های مورد بررسی در مطالعة حاضر در سطح توالی نوکلئوتیدی و آمینواسیدی ژن و گلیکوپروتئین HN به ترتیب به‌میزان 2/99درصد و 9/98درصد با یکدیگر شباهت داشتند. پس از ترسیم درخت‌های شجره‌شناسی بر اساس توالی کامل ناحیة کد شوندة ژن HN (1716 باز) و توالی ناکامل ژن F (270 باز، ناحیة با تغییرپذیری بالا)، نمایندگان ویروسی تمامی ژنوتیپ‌ها و تحت ژنوتیپ‌های شناخته شدة NDV بر اساس الگوهای انشعاب و توپولوژی درخت، از یکدیگر به وضوح قابل تفریق بودند (تصاویر 1،2). جدایه‌های ویروسی مورد مطالعه در هر دو درخت شجره‌شناسی رسم شده در مطالعة حاضر همراه با جدایه‌های به دست آمده از کشورهای سوئد، روسیه، بروندی، هند و پاکستان در خوشه‌ای واحد که دربرگیرندة ویروس‌های شناخته شدة ژنوتیپ XIII بود، قرار گرفتند. درصد تشابه نوکلئوتیدی و آمینواسیدی جدایه‌های تعیین هویت شده در مطالعة حاضر با سویه‌های متداول واکسینال در ایران (Lasota، B1 و PHY-LMV42) در طول توالی ژن (1716 باز، ناحیة کُد شونده) و گلیکوپروتئین HN (571 اسید آمینه) در جدول 3 قابل مشاهده می‌باشد. تحلیل توالی‌ها نشان داد که جدایه‌های ایرانی NDV بیشترین تفاوت نوکلئوتیدی و آمینواسیدی در سطح ژن و گلیکوپروتئین HN را با سویة واکسینال لاسوتا دارند. فاصلة تکاملی تخمینی و درصد شباهت نوکلئوتیدی جدایه‌های مورد مطالعه با سویه‌های شناخته شدة متعلق به تیپ‌های ژنومی مختلف NDV بر اساس تحلیل توالی ژن HN، در جداول 4 و 5 بیان گردیده‌اند.

بحث

 

بیماری نیوکاسل به‌عنوان یکی از اصلی‌ترین تهدیدات در راستای محدودسازی توسعة صنعت پرورش طیور تجاری در سراسر دنیا شناخته می‌شود. با وجود کاربرد گستردة واکسن‌های فعال و غیرفعال علیه این بیماری هم‌اَکنون با حضور بومی یا اندمیک ND در گله‌های طیور تجاری ایران روبه‌رو هستیم؛ و واگیری‌های شدید بیماری به‌صورت مداوم در سراسر کشور گزارش می‌گردند (8،14،34). حضور واریانت‌های پادگنی ویروس بیماری نیوکاسل (NDV) شاید اثرات برجسته‌ای بر وقوع واگیری‌های بیماری نیوکاسل حتی در گله‌های واکسینه داشته باشد. از این‌رو، تعیین هویت جدایه‌های NDV عامل بروز واگیری‌های شدید بیماری بسیار واجد اهمیت است و اطلاعات حاصل از این مسیر در راستای انتخاب سویه‌های واکسینال مناسب مورد نیاز می‌باشد زیرا ارتباط نزدیک‌تر سویه‌های واکسینال با ویروس‌های فیلدی عامل بروز واگیری‌ها به فراهم‌سازی حمایت قابل اعتمادتر در پرندگان واکسینه منجر خواهد شد (31).

این اعتقاد وجود دارد که سویه‌های بیماری‌زای NDV در نواحی جغرافیایی دارای بیماری به‌شکل اندمیک، به‌صورت مداوم تحت اثر عوامل ایجاد تکامل و تغییر شکل هستند؛ بنابراین، همانگونه که در دیگر نقاط جهان مشاهده گردیده است کشورهایی مثل کشور ما ایران شاید محل مناسبی برای نوپدیدی ویروس‌های جدید باشند (35). از طرفی، RNA پلیمراز ویروس بیماری نیوکاسل عملکردی بسیار پرخطا دارد و در طول فرایند تکثیر RNA بروز موتاسیون‌های فراوان در نتیجة عملکرد این آنزیم دور از ذهن نیست و این موتاسیون‌ها در بسیاری از موارد به شکل‌گیری واریانت‌های پادگنی جدید منجر خواهد شد. به‌علاوه، فشار انتخاب ایمنی نیز یکی از دیگر عوامل تاثیرگذار بر شکل‌گیری سویه‌های واریانت جدید است. ژن HN بیش از دیگر ژن‌های NDV تحت تاثیر فشار انتخاب ایمنی در نتیجة تولید پادتن‌های ضد ویروس قرار می‌گیرد و در مقایسه با دیگر ژن‌های NDV تحت فشار ایمنی یکسان احتمال بروز موتاسیون‌های نوکلئوتیدی در HN محتمل‌تر است (12). از سویی دیگر، افزایش فاصلة فیلوژنتیک و پادگنی موجود بین سویه‌های واکسینال متداول و سویه‌های فیلدی در حال چرخش شاید به شکل‌گیری سویه‌های بیماریزای جدید NDV منجر گردد؛ و بنابراین، تداوم بروز واگیری‌های بیماری نیوکاسل در ایران شاید ناشی از این موضوع باشد (39).

در مطالعة حاضر، ژن HN در دو جدایة ویروس بیماری نیوکاسل که در گذشته از مزارع پرورش طیور تجاری استان اصفهان جداسازی شده بودند، به‌شکل کامل تعیین توالی شد. هدف این مطالعه تعیین سطح ارتباط ژنتیکی موجود بین سویه‌های واکسینال متداول (Lasota، B1 و PHY-LMV42) با جدایه‌های فیلدی و عامل واگیری‌های بیماری نیوکاسل در ایران بود. این دو جدایه در سطح توالی آمینواسیدی گلیکوپروتئین HN با یکدیگر 9/98درصد برابری داشتند؛ درحالی‌که، این طیف برابری بین سویه‌های فیلدی کشور ما ایران (جدایه‌های مورد بررسی در مطالعة حاضر) و سویه‌های واکسینال متداول از 1/88درصد تا 3/85درصد متغیر بود. این اعداد بیان‌گر این مفهوم هستند که سویه‌های ویروسی در حال گردش در استان اصفهان به‌‎‎عنوان نمایندة ویروس‌های در حال گردش در ایران به‌شکل معنی‌دار از سویه‌های واکسینال مورد مصرف برای واکسیناسیون گله‌های تجاری متفاوت هستند؛ و بنابراین، نقش تفاوت‌های پادگنی در شکل‌گیری حمایت ضعیف ناشی از واکسن‌ها را می‌توان به‌عنوان فرض در نظر داشت. به عبارتی این تغییرات شاید مسئول بروز اختلال در عملکرد ایمنی‌زایی واکسن‌ها در برابر ویروس‌های در گردش فیلد در سال‌های اخیر بوده باشند؛ و از این‌رو، شاید بتوان وقوع مکرر واگیری‌های بیماری نیوکاسل در نقاط مختلف کشور را با این موضوع در ارتباط دانست. نتایج مطالعة حاضر با یافته‌های حاصل از یک مطالعة اخیر که جابه‌جایی‌های آمینواسیدی را به‌دنبال تعیین توالی ناکامل ناحیة کد شوندة ژن HN در جدایه‌های NDV جداسازی شده از نواحی مختلف ایران در مقایسه با سویه‌های لنتوژنیک شناخته شده نشان داده بود؛ تا حدود زیادی برابری داشت. بیشتر جابه‌جایی‌های آمینواسیدی مشاهده شده در توالی ژن HN بین سویه‌های بیماریزا و سویه‌های لنتوژن (واکسینال) در مطالعة حاضر با مشاهدات مطالعة مذکور یکسان بودند (داده‌های غیر انتشار یافته)؛ با این‌حال، تفاوت‌های اندکی در این رابطه بین دو مطالعه وجود داشت. به‌عبارتی، در مقایسه با جدایه‌های بیماریزایی که در مطالعة مذکور مورد بررسی قرار گرفته بودند، در هیچ یک از جدایه‌های مورد بررسی در مطالعة حاضر جابه‌جایی آمینواسیدی در جایگاه 550 مشاهده نشد (9). جایگاه آمینواسیدی 550 در مجاورت جایگاه‌های پادگنی، کاتالایتیک و گلیکوزیلاسیون گلیکوپروتئین HN واقع شده‌ است و نقش بالقوة این جایگاه در شکل‌گیری ساختار پادگنی و پتانسیل ایمنی‌زایی جدایه‌های NDV باید مورد مطالعة بیشتری قرار گیرد. محققین در گذشته نشان داده‌اند که تغییرات بسیار کوچک در توالی نوکلئوتیدی سویه‌های NDV شاید اثرات برجسته‌ای در رابطه با تغییر خصوصیات بیماریزایی ویروس در پی داشته باشد (24). در مجموع، داده‌های حاصل از این مطالعه بر نیاز به ارزیابی سویه‌های واکسینال متداول به ‌منظور تعیین توان ایمنی‌زایی این واکسن‌ها در برابر ویروس‌های بومی در حال گردش در کشور ما تأکید داشت.

طول ناحیة کدشوندة ژن HN در سویه‌های مختلف NDV شاید متغیر باشد. به‌نحوی‌که در نتیجة حضور کودون پایان دهندة ترجمه، در نواحی مختلف ژن، امکان کُدشدن پروتئین‌هایی با طول مختلف (از 571 تا 616 اسید آمینه) به‌وسیلة این ژن وجود دارد (33). از سویی دیگر، ارتباط بین طول پروتئین HN و توان بیماریزایی ویروس در گذشته نشان داده شده است. ژن HN در سویه‌های استاندارد غیربیماری‌زا یا دارای بیماری‌زایی اَندک، ناحیة کدشوندة وسیع‌تری دارد به‌نحوی‌که قادر به کُد کردن پروتئین‌هایی طویل‌تر حتی با طول 616 اسید آمینه می‌باشد (33). در مطالعة حاضر، بررسی طول انتهای کربوکسیل و متغیر گلیکوپروتئین HN در ویروس‌های مورد مطالعه، هیچگونه اتساع آمینواسیدی در این ناحیه را نشان نداد و طول گلیکوپروتئین HN در هر دو جدایة مورد بررسی برابر با 571 اسید آمینه پیش‌بینی شد که با توجه به داده‌های ارائه شده در این رابطه، بیان‌گر بیماریزا بودن تمامی جدایه‌های مورد مطالعه است. همچنین، الگوی مولتی بازیک محل شکاف گلیکوپروتئین F در این جدایه‌ها نیز دیگر یافتة ملکولی حاکی از بیماریزایی این دو جدایه بود. قبلاً نشان داده شده است که سویه‌هایی از NDV که واجد کوتاه‌ترین طول گلیکوپروتئین HN (571 اسید آمینه) هستند؛ انحصاراً، تشکیل دهندة سویه‌های ویسروتروپیک و ولوژنیک NDV می‌باشند (4).

سویه‌های ویروس بیماری نیوکاسل بر اساس تغییرات ژنتیکی و بررسی‌های فیلوژنتیک مبتنی بر طول کامل ناحیة کُدشوندة ژن F، در بسیاری از جدایه‌های ویروسی به دست آمده از نواحی مختلف دنیا، در دو کلاس مختلف (I و II) طبقه‌بندی می‌شوند. کلاس I ویروس‌های بیماری نیوکاسل تنها دربرگیرندة یک ژنوتیپ و حاوی ویروس‌های غیربیماریزا با طول ژنوم 15.198 نوکلئوتید است. درحالی‌که، سویه‌های کلاس II متشکل از 18 ژنوتیپ مختلف هستند و این تیپ‌های ژنومی دربرگیرندة هر دو پاتوتیپ غیربیماریزا و بیماریزا با طول ژنوم به‌ترتیب 15.186 و 15.192 نوکلئوتید می‌باشند (4،5،6،36). در نتیجة سرعت فراوان تغییرات تکاملی سویه‌های NDV، در طی چند دهة گذشته ژنوتیپ‌های جدید و متعددی از این ویروس گزارش شده‌اند و بدون شک این روند در سالیان آینده نیز ادامه خواهد داشت (22). بررسی‌های فیلوژنتیک، براساس طول کامل ناحیة کدشوندة ژن HN در دو جدایة مورد بررسی در مطالعة حاضر، نشان داد که این جدایه‌ها ارتباط بسیار نزدیکی با سویه‌های شناخته شدة متعلق به ژنوتیپ XIII و تحت ژنوتیپ XIIIa دارند. سویه‌های ژنوتیپ XIII، که در گذشته در کشور ما ایران به‌عنوان سویه‌های ژنوتیپ VII در نظر گرفته می‌شدند (8،34) دربرگیرندة ویروس‌های بیماریزای بیماری نیوکاسل هستند که بین سال‌های 1997 و 2014 در پاکستان، روسیه، بوروندی، هند و سوئد جداسازی و تعیین هویت شده‌اند (3،16،19،25،27،38). جداسازی ویروسی متعلق به تحت ژنوتیپ XIIIa از یک قطعه پرستوک دریایی وحشی (Wild Little Tern, Sterna albifrons) در روسیه در سال 2001 میلادی بیان‌گر احتمال سرریز ویروس‌های بیماری نیوکاسل از طیور به جمعیت‌های پرندگان وحشی و نقش بالقوة این پرندگان در انتشار ویروس بود (38). اختلاف ژنی اندک موجود بین جدایه‌های به دست آمده از کشور ایران با جدایه‌های جداسازی شده در کشورهای روسیه، هند و سوئد به وضوح بیان‌گر وقوع انتشار داخل قاره‌ای و بین قاره‌ای ویروس‌های متعلق به این ژنوتیپ است؛ و همچنین، احتمال انتشار گستردة دیگر ژنوتیپ‌ها را نیز بین کشورهای نام برده گوش‌زد می‌کند. تداخلات انسانی در ارتباط با پرورش طیور تجاری و تجارت پرندگان همراه (26)، در بسیاری از موارد به‌عنوان محتمل‌ترین عامل انتشار ویروس‌های بیماریزای NDV در سراسر دنیا در نظر گرفته می‌شود؛ با این‌حال، دخالت پرندگان مهاجر در انتشار NDV به گله‌های طیور را نیز نمی‌توان نادیده انگاشت (29).جداسازی تعداد بیشتری از جدایه‌های NDV در ایران و کشورهای همسایه در منطقه و به‌دنبال آن تعیین هویت ملکولی و بیولوژیک این جدایه‌ها در راستای تعیین ماهیت ویروس‌های بومی در حال گردش در کشور ما و منطقه بسیار مفید خواهد بود و دانستنی‌های ما را در ارتباط با تکامل و شکل‌گیری سویه‌های بیماریزای NDV در منطقه ارتقأ خواهد داد.

 متاسفانه، به‌دلیل عدم دسترسی به توالی کامل ژن HN،  در این مطالعه مقایسة ویروس‌های مورد بررسی با بسیاری از دیگر جدایه‌های NDV به دست آمده از ایران و کشورهای همسایه در سا‌ل‌های اخیرامکان‌پذیر نبود؛ با این وجود، از آنجایی‌که طبق گزارش‌های معتبر تجزیه و تحلیل جداگانة ژن‌های F و HN به‌منظور ارزیابی فیلوژنتیک جدایه‌های NDV به طبقه‌بندی مشابه سویه‌های ویروسی انجامیده است (27،36)، نتایج تجزیه و تحلیل‌های فیلوژنتیک ارائه شده در این مطالعه را می‌توان قابل اعتماد در نظر گرفت. در مطالعة حاضر نیز همانگونه که در تصاویر 1 و 2 قابل مشاهده است، تحلیل شجره‌شناسی توالی کامل ناحیة کد شوندة ژن HN (1716 باز) و تحلیل توالی ناکامل ژن F در ناحیة با تغییرپذیری بالا (270 باز) نتایج یکسانی را در راستای تعیین تیپ‌های ژنی جدایه‌های NDV حاصل کردند. تا به امروز، چرخش ویروس‌های متعلق به تحت ژنوتیپ‌های XIIIa، VIIj و VIId در طیور تجاری (8،11،14،34)، تحت ژنوتیپ VIb در کبوترهای اهلی (30) و اخیراً تحت ژنوتیپی جدید از تیپ ژنی VII در ماکیان خانگی (32) در ایران به اثبات رسیده است؛ با این وجود، اطلاعات ما در ارتباط با اپیدمیولوژی ملکولی و ویژگی‌های بیولوژیک ویروس‌های بیماریزای NDV در کشور بسیار محدود است. به همین دلیل، به‌منظور تعیین مخازن احتمالی ویروس و انواع ژنوتیپ‌های NDV دخیل در بروز واگیری‌های بیماری نیوکاسل در ایران، تعیین هویت وسیع ملکولی و انجام مطالعات فیلوژنتیک جدایه‌های NDV به دست آمده از جمعیت‌های طیور تجاری، پرندگان همراه و پرندگان آزاد پرواز در کشور ضروری به نظر می‌رسد. البته باید توجه داشت که شناسایی حضور تحت ژنوتیپ‌های XIIIa ، VIId و VIb از طریق تحلیل توالی ناکامل ژن F  و توالی ژن HN در جدایه‌های NDV به دست آمده از ایران صورت پذیرفته است؛ و بنابراین، بر اساس استانداردهای تعیین شده، این داده‌ها را قبل از تعیین توالی کامل ناحیة کد شوندة ژن F در این جدایه‌ها نمی‌توان به‌طور کامل قطعی و مورد اعتماد در نظر گرفت (6).

نتیجه گیری نهایی: به طور کلی، این مطالعه به‌دنبال تعیین توالی ژن و گلیکوپروتئین HN بیان‌گر تفاوت ژنی و آمینو اسیدی معنی‌دار جدایه‌های مورد مطالعه و بومی NDV در ایران با سویه‌های متداول واکسینال بود. ارزیابی‌های شجره‌شناسی انجام شده در مطالعة حاضر بر اساس توالی ژن‌های F (270 باز) و HN (1716 باز) به‌شکل جداگانه، به نتایج یکسانی منجر گردید و ظاهراً بخش‌های مختلف ژنوم NDV از این نظر با یکدیگر در ارتباط هستند. قرابت شجره‌شناسی جدایه‌های مورد بررسی در مطالعة حاضر با جدایه‌هایNDV جداسازی شده از پرندگان وحشی در کشور روسیه و جدایه‌های به دست آمده از شمال اروپا (سوئد) احتمالاً بیانگر نقش برجستة پرندگان وحشی مهاجر در انتشار گستردة سویه‌های NDV و اهمیت فراوان اعمال تدابیر امنیت زیستی مستحکم در این رابطه، می‌باشد.

سپاسگزاری

این پژوهش با استفاده از اعتبارات تحقیقاتی شماره 18/6/7508007  شورای پژوهشی دانشگاه تهران و شماره 0443011700/77 موسسه واکسن و تحقیقات سرم سازی رازی کرج انجام شد.

تعارض منافع

بین نویسندگان تعارض در منافع گزارش نشده است.

 

جدول 1. مشخصات مربوط به جدایة های  NR15 و NR16 ویروس بیماری نیوکاسل این مطالعه

 

نام جدایه

محل جداسازی

توالی مربوط به محل شکاف گلیکوپروتئین F

کد دسترسی ژن

F

کد دسترسی ژن HN

NDV/Chicken/Iran/NR15/1999

اصفهان

112RRQRRF117

JN001189

KX034120

NDV/Chicken/Iran/NR16/1999

اصفهان

112RRQRRF117

EU049539

KX058520

 

 

 

جدول 2.  مشخصات و توالی پرایمرهای طراحی شده برای تکثیر ژن هماگلوتینین-نورآمینیداز (HN)

 

نام پرایمر

توالی

جایگاه اتصال

TM

(Cº)

GC%

اندازة محصول PCR (bp)

HN1-F

GCACAGCAAAAGACCTTACTATG

6140-6162

1/58

4/43

899

HN1-R

TGCTAAGTATTGATGTGAATGTG

7016-7038

5/55

7/34

HN2-F

ACGAATAATAGCGGGTGTGG

6769-6788

8/59

0/50

900

HN2-R

GCCTCGTTGGTACAAGAAGTG

7648-7668

7/59

3/52

HN3-F

TAATAACACATGCCCCGATG

7437-7456

2/59

0/45

877

HN3-R

GCGACTAAAGAAGGGACTCAG

8293-8313

2/58

3/52

 

 

 

جدول 3. تشابه نوکلئوتیدی و آمینو اسیدی دو جدایة  NR15 و NR16 با سویه‌های متداول واکسینال NDV

 

سویه‌های متداول واکسینال NDV

NR15

NR16

شباهت نوکلئوتیدی (%)

شباهت آمینواسیدی (%)

شباهت نوکلئوتیدی (%)

شباهت آمینواسیدی (%)

Lasota

2/79

1/86

1/79

3/85

B1

5/79

9/85

5/79

5/85

PHY-LMV42

1/82

1/88

6/81

3/87

 

 

 

 جدول 4. فاصلة تکاملی دو جدایة NR15 و NR16 از نمایندگان ویروسی تیپ‌های ژنومی مختلف ویروس بیماری نیوکاسل

 

تیپ ژنی

I

II

III

IV

V

VI

VII

VIII

IX

X

XI

XII

XIII

XIV

XVI

XVII

XVIII

NR15

I

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

II

096/0

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

III

082/0

133/0

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

IV

091/0

138/0

083/0

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

V

159/0

195/0

154/0

134/0

 

 

 

 

 

 

 

 

 

 

 

 

 

 

VI

134/0

185/0

126/0

103/0

115/0

 

 

 

 

 

 

 

 

 

 

 

 

 

VII

161/0

209/0

162/0

136/0

139/0

086/0

 

 

 

 

 

 

 

 

 

 

 

 

VIII

145/0

190/0

146/0

122/0

126/0

111/0

142/0

 

 

 

 

 

 

 

 

 

 

 

IX

165/0

211/0

167/0

144/0

142/0

090/0

015/0

147/0

 

 

 

 

 

 

 

 

 

 

X

073/0

109/0

111/0

117/0

182/0

160/0

178/0

160/0

183/0

 

 

 

 

 

 

 

 

 

XI

151/0

200/0

147/0

106/0

188/0

166/0

194/0

187/0

201/0

187/0

 

 

 

 

 

 

 

 

XII

175/0

216/0

180/0

156/0

151/0

115/0

111/0

153/0

120/0

196/0

213/0

 

 

 

 

 

 

 

XIII

164/0

207/0

161/0

134/0

136/0

090/0

086/0

138/0

093/0

187/0

183/0

102/0

 

 

 

 

 

 

XIV

168/0

208/0

164/0

139/0

147/0

100/0

101/0

147/0

109/0

184/0

201/0

114/0

088/0

 

 

 

 

 

XVI

177/0

220/0

178/0

153/0

162/0

150/0

166/0

158/0

175/0

200/0

201/0

185/0

174/0

175/0

 

 

 

 

XVII

180/0

223/0

184/0

150/0

163/0

119/0

118/0

157/0

125/0

204/0

212/0

135/0

102/0

107/0

187/0

 

 

 

XVIII

179/0

229/0

185/0

160/0

161/0

121/0

115/0

159/0

118/0

207/0

213/0

131/0

108/0

105/0

187/0

119/0

 

 

NR15

165/0

210/0

164/0

134/0

137/0

092/0

088/0

138/0

095/0

188/0

184/0

106/0

006/0

093/0

177/0

108/0

113/0

 

NR16

170/0

211/0

169/0

139/0

141/0

098/0

094/0

140/0

100/0

190/0

190/0

109/0

011/0

097/0

180/0

112/0

118/0

008/0

 

 

 

تصویر 1. درخت شجره‌شناسی بر اساس تحلیل توالی کامل (1716 باز) ناحیة کد شوندة ژن HN ویروس‌های بیماری نیوکاسل با شمارة دسترسی جدایه ها. جدایه‌های NR15 و NR16 با  دوایر مشکی رنگ مشخص شده‌اند

 

 

تصویر 2. درخت شجره‌شناسی بر اساس تحلیل توالی ناکامل (270 باز) ناحیة کد شوندة ژن فیوژن (F) ویروس‌های بیماری

 

 

جدول 5. قرابت نوکلئوتیدی جدایه‌های NR15 و NR16 با نمایندگان ویروسی هر یک از ژنوتیپ‌های شناخته شدةNDV  بر اساس توالی ژن HN

 

تیپ‌های ژنی NDV

قرابت نوکلئوتیدی (%)

 

NR15

NR16

I

5/83

83

II

79

79

III

6/83

83

IV

5/86

86

V

3/86

86

VI

8/90

2/90

VII

2/91

6/90

VIII

2/86

86

IX

5/90

90

X

2/81

90

XI

6/81

90

XII

4/89

1/89

XIII

3/99

9/98

XIV

7/90

3/90

XVI

3/82

82

XVII

3/89

8/88

XVIII

7/88

2/88

 

  1. Alexander, D.J., Aldous, E.W., Fuller, C.M. (2012). The long view: a selective review of 40 years of Newcastle disease research. Avian Pathol. 41, 329-335.
  2. Bozorgmehri-Fard, M.H., Keyvanfar, H. (1979). Isolation of Newcastle disease virus from teals (Anas crecca) in Iran. J Wildl Dis. 15, 335-337.
  3. Cattoli, G., Fusaro, A., Monne, I., Molia, S., Le Menach, A., Maregeya, B., Nchare, B., Bangana, I., Garba Maina, A., N’Goran Koffi, J.N., Thiam, H., Bezeid, O.E.M.A., Salviato, A., Nisi, R., Terregino, C., Capua, I. (2010). Emergence of a new genetic lineage of Newcastle disease virus in West and Central Africa—Implications for diagnosis and control. Vet Microbiol. 142, 168-176.
  4. Czeglédi, A., Ujvari, D., Somogyi, E., Wehmanna, E., Werner, O., Lomniczi, B. (2006). Third genome size category of avian paramyxovirus serotype 1 (Newcastle disease virus) and evolutionary implications. Virus Res. 120, 36-48.
  5. De Almeida, R.S., Hammoumi, S., Gil, P., Briand, F., Molia, S., Gaidet, N., Cappelle, J., Chevalier, V., Balanc, G., Traore, A., Grillet, C., Maminiaina, O.F., Guendouz, S., Dakouo, M., Samake, K., El Mamy Bezeid, O., Diarra, A., Chaka, H., Goutard, F., Thompson, P., Martinez, D., Jestin, V., Albina, E. (2013). New avian paramyxoviruses type I strains identified in Africa provide new outcomes for phylogeny reconstruction and genotype classification. PLOS ONE, 8, e76413.
  6. Diel, D.G., da Silva, L.H.A., Liu, H., Wang, Z., Miller, P.J., Afonso, C.L. (2012). Genetic diversity of avian paramyxovirus type 1: proposal for a unified nomenclature and classification system of Newcastle disease virus genotypes. Infect Genet Evol. 12, 1770-1779.
  7. Dortmans, J.C.F.M., Koch, G., Rottier, P.J.M., Peeters B.P.H. (2009). Virulence of pigeon paramyxovirus type 1 does not always correlate with the cleavability of its fusion protein. J Gener Virol. 90, 2746-2750.
  8. Ebrahimi, M.M., Shahsavandi, S., Moazenijula, G.R., Shamsara, M. (2012). Phylogeny and evolution of Newcastle disease virus genotypes isolated in Asia during 2008–2011. Virus Gen. 45, 63-68.
  9. Esmaelizad, M., Ashtiani, M.P. (2015). Comparative analysis of sialidase protein in velogenic and lentogenic strains of Newcastle Disease Virus. Acta Virol. 59, 194-195.
  10. Esmaelizad, M., Ashtiani, M.P., Jelokhani-Niaraki, S., Hashemnejad, K. (2012). Identification of 23 specific nucleotide patterns in the HN gene of Newcastle disease viruses isolated from Iran. Turk J Biol. 36, 135-142.
  11. Esmaelizad, M., Mayahi, V., Pashaei, M., Goudarzi, H., (2016). Identification of novel Newcastle disease virus sub-genotype VII-(j) based on the fusion protein. Arch. Virol. Published Online: 21 December 2016.
  12. Gong, Y.Y., Cui, Z.Z. (2011). Epitope variation in the Newcastle disease virus HNgene under antibody immune selective pressure in cell culture. Sci. China Life Sci. 54, 474-479.
  13. Hall, T.A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser. 41, 95–98.
  14. Hosseini, H., Ghalyanchi Langeroudi, A., Torabi, R. (2014). Molecular characterization and phylogenetic study of Newcastle disease viruses isolated in Iran, 2010–2012. Avian Dis. 58, 373-376.
  15. Kai, Y., Hu, Z., Xu, H., Hu, S., Zhu, J., Hu, J., Wang, X., Liu, X., Liu, X. (2015). The M, F and HN genes of genotype VIId Newcastle disease virus are associated with the severe pathological changes in the spleen of chickens. Virol J. 12, 133.
  16. Kumar, U., Kumar, S. (2015). Molecular characterization of an apoptotic strain of Newcastle disease virus isolated from an outbreak in India. Cancer Gene Ther. 22, 402-409.
  17. Kumar, S., Stecher, G., Tamura, K. (2015). MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol. 33, 1870-1874.
  18. Lamb, R.A., Kolakofsky, D. (1996). Paramyxoviridae: the viruses and their replication. In: Fields Virology. Fields, B.N., Knipe, D.M., Howley, P.M. (Eds.). (3rd Edn.). Philadelphia, PA: Lippincott-Raven. P. 1177-1203.
  19. Linde, A.M., Munir, M., Zohari, S., Ståhl, K., Baule, C., Renström, L., Berg, M. (2010). Complete genome characterisation of a Newcastle disease virus isolated during an outbreak in Sweden in 1997. Virus Gen. 41, 165-173.
  20. Mayo, M.A. (2002a). Virus Taxonomy – Houston 2002. Arch Virol. 147, 1071-1076.
  21. Mayo, M.A. (2002b). A summary of taxonomic changes recently approved by ICTV. Arch Virol. 147, 1655-1656.
  22. Miller, P.J., Haddas, R., Simanov, L., Lublin, A., Rehmani, S.F., Wajid, A., Bibi, T., Khan, T.A., Yaqub, T., Setiyaningsih, S., Afonso, C.L. (2015). Identification of new sub-genotypes of virulent Newcastle disease virus with potential panzootic features. Infect Genet Evol. 29, 216-229.
  23. Miller, P.J., Koch, G. (2013). Newcastle disease. In: Diseases of Poultry. Swayne, D.E., Glisson, J.R., McDougald, L.R., L.K. Nolan, L.K., Suarez D.L., Nair. V. (Eds.). (13th Edn.). Ames: Wiley- Blackwell. P. 89-107.
  24. Mohamed, M.H.A., Kumar, S., Paldurai, A., Megahed, M.M., Ghanem, I.A., Lebdah, M.A., Samal, S.K. (2009). Complete genome sequence of a virulent Newcastle disease virus isolated from an outbreak in chickens in Egypt. Virus Gen. 39, 234–237.
  25. Morla, S., Tiwari, K.A., Joshi, V., Kumar, S. (2014). Complete genome sequence of a Newcastle disease virus isolate from an outbreak in northern India.Genome Announc. 2:e00342-14.
  26. Munir, M., Abbas, M., Khan, M.T., Zohari, S., Berg, M. (2012a). Genomic and biological characterization of a velogenic Newcastle disease virus isolated from a healthy backyard poultry flock in 2010. Virol J. 9:46.
  27. Munir, M., Zohari, S., Abbas, M., Berg, M. (2012b). Sequencing and analysis of the complete genome of Newcastle disease virus isolated from a commercial poultry farm in 2010. Arch Virol. 157,  765-768.
  28. OIE (World Animal Health Organization) (2012) Newcastle disease. In: Manual of Diagnostic Tests and Vaccines for Terrestrial Animals: Mammals, Birds and Bees. Paris: Office International des Epizooties. P. 555–573.
  29. Ramey, A.M., Reeves, A.B., Ogawa, H., Ip, H.S., Imai, K., Bui, V.N., Yamaguchi, E., Silko, N.Y., Afonso, C.L. (2013). Genetic diversity and mutation of avian paramyxovirus serotype 1 (Newcastle disease virus) in wild birds and evidence for intercontinental spread. Arch Virol. 158, 2495-2503.
  30. Rezaei Far, A., Peighambari, S.M., Pourbakhsh, S.A., Ashtari, A., Soltani, M. (2016). Co-circulation of genetically distinct groups of avian paramyxovirus type 1 in pigeon Newcastle disease in Iran. Avian Pathol. 46, 36-43.
  31. Roohani, K., Tan, S.W., Yeap, S.K., Ideris, A., Bejo, M.H., Omar, A.R. (2015). Characterization of genotype VII Newcastle disease virus (NDV) isolated from NDV vaccinated chickens, and the efficacy of LaSota and recombinant genotype VII vaccines against challenge with velogenic NDV. J Vet Sci. 16, 447-457.
  32. Sabouri, F., Vasfi Marandi, M., Karimi, V., Malekan, M., Bashashati, M. (2016). Genetic analysis of avian paramyxovirus type I strains isolated from backyard poultry in Iran. Turk J Vet Anim Sci. 40, 750-756.
  33. Sakaguchi, T., Toyoda, T., Gotoh, B., Inocencio, N.M., Kuma, K., Miyata, T., Nagai, Y. (1989). Newcastle disease virus evolution I. Multiple lineages defined by sequence variability of the Haemagglutinin-neuraminidase gene. Virology. 169, 260-272.
  34. Samadi, S., Kianizadeh, M., Najafi, M.F., Mousavi Nasab, S.D., Davatgar, A.M.H., Royaee, A., Pilvar, P. (2014). Molecular characterization and phylogenetic study of velogenic Newcastle disease virus isolates in Iran. Virus Gen. 48, 290-295.
  35. Samuel, A., Nayak, B., Paldurai, A., Xiao, S., Aplogan, G.L., Awoume, K.A., Webby, R.J., Ducatez, M.F., Collins, P.L., Samal, S.K. (2013). Phylogenetic and pathotypic characterization of Newcastle disease viruses circulating in West Africa and efficacy of a current vaccine.J Clin Microbiol. 51,771-781.
  36. Snoeck, C.J., Owoade, A.A., Couacy-Hymann, E., Alkali, B.R., Okwen, M.P., Adeyanju, A.T., Komoyo, G.F., Nakouné, E., Faou, A.L., Muller, C.P. (2013). High genetic diversity of Newcastle disease virus in poultry in West and Central Africa: cocirculation of genotype XIV and newly defined genotypes XVII and XVIII. J Clin Microbiol. 51, 2250-2260.
  37. Tamura, K., Nei, M. (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 10 , 512-526.
  38. Usachev, E.V., Fediakina, I.T., Shchelkanov, M.I., L'vov, D.N., Prilipov, A.G., Iamnikova, S.S. (2006). Molecular genetic characteristics of the Newcastle Sterna/Astrakhan/Z275/2001 virus isolated in Russia. Mol. Genet. Mikrobiol. Virusol. 1, 14-20. [Article in Russian]
  39. Zhang, Y., Zhang, S., Wang, X., Zhang, G. (2012). Complete genome sequence of a subgenotype VIId Newcastle disease virus circulating predominantly in chickens in China. J Virol. 86, 13849-13850.