بکارگیری تکنیک نوین ترکیب PCR کمی با پروپیدیوم مونوآزید جهت شمارش استافیلوکوکوس اورئوس انتروتوکسیژنیک در محصولات خامه‌ای قنادی

نوع مقاله: بهداشت مواد غذایی

نویسندگان

گروه بهداشت مواد غذایی، دانشکده دامپزشکی، دانشگاه تخصصی فن آوری‌های نوین آمل، آمل، ایران

چکیده

زمینۀ مطالعه: استافیلوکوکوس اورئوس یکی از پاتوژن­های مهم انسانی است که عامل بروز عفونت بوده و نیز با تولید انواع مختلف انتروتوکسین­ها موجب مسمومیت­های غذایی می­گردد. استفاده از روش­های معمول کشت جهت شمارش استافیلوکوکوس اورئوس دارای محدودیت­هایی مانند مدت زمان طولانی برای رشد باکتری و فقدان حساسیت و دقت لازم در مورد سلول­های زنده غیر­قابل کشت می­باشد.
هدف: هدف از انجام این پژوهش جستجو و شمارش استافیلوکوکوس اورئوس تولید کننده انتروتوکسین­های A-E در محصولات خامه­ای قنادی با استفاده از روش  PCR زمان واقعی در ترکیب با پروپیدیوم مونوآزید (PMA) جهت تفکیک سلول­های زنده از مرده بود.
روش‌کار: تعداد 100 نمونه شیرینی خامه­ای به مدت 2 ماه و به صورت تصادفی از کارگاه­های قنادی شهر آمل تهیه شد. پس از تهیه رقت از نمونه، پلت­های باکتریایی جداسازی و قبل از استخراجDNA ، با PMA تیمار شدند. PCR زمان واقعی جهت شمارش کل سلول­های استافیلوکوکوس اورئوس و نیز سویه­های انتروتوکسیژنیک آن با استفاده از پرایمرهای اختصاصی انجام شد.
نتایج: نتایج شمارش کشت معمولی به نتایج PMA-qPCR بسیار نزدیک بود (05/0<P)، لیکن داده­های به دست آمده از qPCR که مجموع سلول­های مرده و زنده را شمارش می­نماید از نتایج دو روش دیگر تعداد بیشتری باکتری را نشان داد. حساسیت روش به کار رفته در این مطالعه جهت جستجوی تعداد اندک استافیلوکوکوس اورئوس (کمتر از 10سلول در گرم) قابل ملاحظه به نظر می­رسد.
نتیجه‌گیری نهایی: یافته­ها نشان داد که استفاده از PCR در ترکیب با  PMAنتایج قابل اعتماد­­تری نسبت به روش معمولی کشت حاصل می­نماید. با توجه به مدت زمان کوتاه حصول نتایج، اختصاصی بودن و حساسیت قابل ملاحظه این روش امید است در آینده نزدیک در آزمایشگاه­های کنترل کیفیت مواد غذایی دستگاه­های نظارتی به کار گرفته شود.

کلیدواژه‌ها


عنوان مقاله [English]

Applying Modern Technique of qPCR Coupling with Propidium Monoazide to Detect Enterotoxigenic Staphylococcus aureus in Cream Pastry Products

نویسندگان [English]

  • Maryam Azizkhani
  • Fahimeh Tooryan
Department of Food Hygiene, Faculty of Veterinary Medicine, Amol University of Special Modern Technologies, Amol, Iran
چکیده [English]

BACKGROUND: Staphylococcus aureus is one of the most important human pathogens that cause infection and also food intoxication by secreting various enterotoxins. Conventional culturing methods to detect S. aureus have some limitations such as being time-consuming due to bacterial growth and low precision and sensitivity in detecting viable but non-cultivable cells.
OBJECTIVES: The objective of this study was to detect and quantify enterotoxigenic (A-E) S. aureus in cream pastry products applying PCR coupling with propidium monoazide (PMA) to distinguish dead and live cells.
METHODS: One hundred samples were randomly collected from pastry shops in Amol, in a period of 2 months. After preparing dilutions, bacterial pellets were separated and treated with PMA before DNA extraction. Real time PCR was conducted in order to quantify S.aureus cells and enterotoxigenic strains using specific primers.
RESULTS: Results of conventional method were close to PMA-qPCR data (P>0.05), but data from qPCR that includes live and dead cells shows more bacterial count than two other methods. Sensitivity of the method applied in the present study, detecting low number of S.aureus cells (less than 10/g) seems considerable.
CONCLUSIONS: Findings showed that applying PCR coupling with PMA results in more reliable data than conventional culturing method. Regarding this approach being time-effective, considerably sensitive and specific, it is expected that it be used in food quality control labs in monitoring systems in future.

کلیدواژه‌ها [English]

  • Staphylococcus aureus
  • Propidium monoazide
  • PCR
  • pastry products
  • Intoxication

مقدمه


باکتری استافیلوکوکوس اورئوس یکی از مهمترین باکتری­های بیماریزا برای انسان و دام به شمار می­رود که انواع مختلفی از انتروتوکسین­ها را تولید می­کند و در میان توکسین­های خارج سلولی (اگزوتوکسین­ها)، توکسین­های استافیلوکوکوس اورئوس بالاترین پتانسیل ایجاد مسمومیت را دارند. در حال حاضر بیش از 15 انتروتوکسین استافیلوکوکی شناخته شده است. این انتروتوکسین­ها، اگزوپروتئین­های مقاوم به حرارت با وزن مولکولی 26000 تا 30000 دالتون هستند که سندرم گاستروانتریت در انسان ایجاد می­کنند. زنجیرهای پلی­پپتیدی منفرد توسط یک پل دی سولفیدی به یکدیگر متصل شده و حلقه سیستینی ویژه­ای را به وجود می­آورند و تصور می­شود که این حلقه قسمت سمی مولکول باشد. از بین انتروتوکسین­های مختلف نوع A و D اغلب عامل مسمومیت­های غذایی هستند و انتروتوکسین A در ایجاد مسمومیت غذایی نسبت به سایر انتروتوکسین­های استافیلوکوکی بیشترین نقش را دارد (1).

بیماری‌های ناشی از غذا یکی از شایع­ترین و عمده­ترین مشکلات بهداشتی – تغذیه‌ای در جهان امروز است که مواد غذایی مختلف در ایجاد آن دخیل می­باشند. از جمله مواد غذایی که آلودگی آن موجب بروز مسمومیت­های شدید می­شود فرآورده­های قنادی به خصوص شیرینی­های حاوی خامه هستند. فرآورده‌های قنادی بخش مهمی از تولیدات غذایی خرده فروشی را در کشور تشکیل می­دهند. با توجه به بالا بودن مصرف شیرینی­های خامه­دار ضروری است که کنترل­های بهداشتی و میکروبیولوژیکی به منظور بالا بردن زمان ماندگاری و حفظ کیفیت این فرآورده­ها و در نهایت تامین سلامت مصرف­کنندگان اعمال گردد. با توجه به گزارشات موارد متعدد در رابطه با عفونت­ها و مسمومیت­های ناشی از مصرف مواد غذایی آلوده و اهمیت انتروتوکسین­های استافیلوکوکی در بهداشت عمومی و بخش­های غذایی، توجه به سلامت غذا و ارائه راهکارهایی جهت حفظ هر چه بیشتر سلامت مواد غذایی در جامعه رو به گسترش است.

استفاده از روش­های سنتی کشت دارای نواقصی از جمله مدت زمان نسبتاً طولانی برای رشد باکتری و فقدان حساسیت لازم در مورد سلول­های زنده غیر قابل کشت می­باشد (11). همچنین، نمی­توان سویه­های تولید­کننده انتروتوکسین را از سویه­های غیر مسمومیت­زا تشخیص داد. PCR زمان واقعی به عنوان یک روش جایگزین امکان تشخیص و تعیین کمی سریع، حساس و اختصاصی عوامل بیماریزا را فراهم می­آورد. علاوه بر این، این تکنیک از طریق پیش تیمار نمونه با عوامل متصل شونده به DNA مانند پروپیدیوم­ مونو ­­آزید، قادر به تمایز بین DNA سلول­های مرده و زنده می­باشد (19). از آنجا که پروپیدیوم مونو‌آزید تنها به درون غشاهای سلولی آسیب­دیده نفوذ می­نماید، این تکنیک بر اساس سالم بودن یا آسیب دیده بودن سلول­های باکتریایی عمل می­نماید (14). پیش تیمار نمونه با  پروپیدیوم مونو­آزید (PMA) و سپس انجام PCR کمی به طور موفقیت‎‌آمیزی برای تشخیص پاتوژن­های باکتریایی مانند لیستریامونوسیتوژنز (17)، اشرشیاکلیO157:H7 (6،7) و کامپیلوباکتر ژژوانی (9) به کار رفته است. نکته قابل ملاحظه در خصوص این روش آنست که  PMAدر مورد همه سلول­های باکتریایی یکسان عمل نمی­کند و در برخی موارد نتایج دور از واقعیت می­باشد. لذا تأثیرگذاری PMA بر باکتری­های مختلف باید به طور اختصاصی برای هر باکتری بررسی گردد. معدودی از مطالعات به جستجوی استافیلوکوکوس اورئوس در مواد غذایی پرداخته­اند لیکن هنوز گزارشی مبنی بر بررسی وضعیت آلودگی نمونه­های واقعی مواد غذایی جمع آوری شده از بازار مصرف جهت اهداف نظارتی و کنترل بهداشتی در دسترس نیست (2،4،21). در این مطالعه به جستجو و شمارش استافیلوکوکوس اورئوس تولید کننده انتروتوکسین­های A-E در محصولات خامه­ای قنادی با استفاده از روش نوین PCR کمی در ترکیب با پروپیدیوم مونوآزید جهت تفکیک سلول­های زنده از مرده و شمارش دقیق­تر و نزدیک به واقعیت باکتری پرداخته شد.

مواد و روش کار

تهیه نمونه: تعداد 100 نمونه شیرینی خامه­ای به مدت 2 ماه و به صورت تصادفی از کارگاه­های قنادی شهر آمل تهیه شد. نمونه­ها در شرایط و ظروف استریل و درکنار کیسة یخ به آزمایشگاه منتقل و تا زمان انجام آزمایشات دریخچال در دمای1±4 درجه سانتیگراد (کمتر از 24 ساعت) نگهداری شدند.

تهیه مواد شیمیایی: کلیه مواد شیمیایی و محیط­های کشت از شرکت مرک (دارمستاد، آلمان) تهیه شد.

شمارش باکتری نمونه­ها در محیط کشت:  نسبت 1 به 10 از نمونه­ها در محلول رینگر استریل تهیه شد، از رقت­های مختلف آن بر روی محیط کشت اختصاصی (برد پارکر آگار) کشت و به مدت 24-18 ساعت در 35 درجه سانتیگراد گرمخانه­گذاری گردید. کلنی­های سیاه رنگ، براق و انحنادار شمارش و در ادامه آزمون­های تاییدی (کشت در محیط مانیتول سالت آگار و تست کاتالاز و کواگولاز) انجام شد.

تیمار با پروپیدیوم مونوآزید: اسلوری نمونه­ها با نسبت 1 به 10 در محلول رینگر در 10000 دور در دقیقه به مدت  30 دقیقه در 4 درجه سانتیگراد سانتریفوژ و پلت باکتریایی جداسازی گردید. پروپیدیوم مونو­آزید (PMA) در دی­متیل سولفوکساید 20 درصد جهت به دست آوردن محلول استوک 20 میلی مول حل و تا زمان استفاده در دمای 20– درجه سانتیگراد در تاریکی نگهداری شد. محلول استوک به 500 میکرولیتر از پلت باکتری تا رسیدن به غلظت نهایی 150 میکرومول افزوده شد (این غلظت بر اساس نتایج آزمون­هایی که با غلظت­های مختلف PMA برای استافیلوکوکوس اورئوس انجام شده بود به دست آمد). پس از افزودن PMA، نمونه‌ها به مدت 5 دقیقه در تاریکی در دمای اتاق قرار گرفته و برای افزایش نفوذ PMA به سلول تکان داده شد. سپس، نمونه­ها به مدت 15 دقیقه با استفاده از سیستم فعال سازی نوری در معرض نور قرار گرفتند. پس از ایجاد اتصالات عرضی از طریق القای نوری، سلول­ها در 7000 دور در دقیقه به مدت 5 دقیقه در4 درجه سانتیگراد سانتریفوژ شده و محلول رویی دور ریخته شد. پلت به دست آمده برای جداسازی  DNA مورد استفاده قرار گرفت (2).

استخراجDNA: محلول استخراج Tripure (Roche, United States) جهت استخراج DNA به کار رفت و کلیه مراحل مطابق دستورالعمل شرکت تولید کننده انجام شد.

انجام PCR: پرایمرهای به کار رفته جهت انجام PCR (جدول 1) از شرکت تکاپوزیست (تهران، ایران) تهیه شد. جهت به دست آوردن منحنی ذوب پرایمرها دامنه حرارتی 95-70 درجه سانتیگراد با شیب 1 درجه سانتیگراد در دقیقه اعمال شد. واکنش Real Time PCR جهت جستجوی ژن مولد انتروتوکسین­های استافیلوکوکی با استفاده از محلول  Power SYBR Green (ایالات متحده(Applied Biosystems,  انجام شد، مستر میکس تهیه شده شامل پرایمرهای forward وreverse  به میزان1 میکرولیتر، الگوی DNA (غلظت نهایی 10 نانوگرم در میکرولیتر)، 10 میکرولیتر مسترمیکس Power SYBR Green و آب فاقد نوکلئاز بود. واکنش در یک ترموسایکلر ABI PRISM 7,500  Sequence Detection System, Applied Biosystems, انجام شد. شرایط چرخه حرارتی واکنش به صورت زیر بود: یک سیکل در  50 درجه سانتیگراد به مدت 2 دقیقه، یک سیکل در  95 درجه سانتیگراد به مدت 2 دقیقه، 40 چرخه در  95 درجه سانتیگراد به مدت 15 ثانیه و 60 درجه سانتیگراد به مدت 1 دقیقه.

آنالیز آماری نتایج حاصله: داده­ها با استفاده از نرم افزار SPSS نسخه 22، نمودار فراوانی و مربع کای مورد آنالیز قرار گرفت. جهت اطمینان از تکرارپذیری نتایج، تیمار نمونه­ها در سه تکرار انجام شد.

نتایج

نتایج شمارش استافیلوکوکوس اورئوس در نمونه­ها به روش‌های کشت معمولی، qPCR و PMA-qPCR در جدول 2 آمده است. همانطور که نتایج نشان می‌دهد، نتایج شمارش با کشت معمولی به نتایج  PMA-qPCRبسیار نزدیک است (05/0<P)، لیکن داده­های به دست آمده از qPCR که مجموع سلول­های مرده و زنده را شمارش می­نماید از نتایج دو روش دیگر تعداد بیشتری باکتری را نشان می ­دهد (05/0>P). تعداد سلول­های مرده با تفریق تعداد سلول­های زنده (نتایج qPCR-PMA) از تعداد کل سلول­ها (نتایج qPCR) به دست می­آید.

نتایج به دست آمده نشان می‌دهد که روش  PMA-qPCR قادر است سلول­های زنده استافیلوکوکوس اورئوس را در ماده غذایی تشخیص داده و شمارش نماید و سلول­های مرده را از تولید سیگنال بازدارد. در جدول 3 تعداد سلول­های استافیلوکوکوس اورئوس حامل ژن­های انتروتوکسین­های استافیلوکوکی که به روش qPCR و  PMA-qPCR شمارش گردیده­اند، آورده شده است.

بحث

کارآیی روش جدید PMA-qPCR در مواد غذایی تلقیح شده به طور مصنوعی مانند سبزیجات و سالاد، شیر پاستوریزه، غلات مورد استفاده در غذای کودک و برنج مورد بررسی قرار گرفته است، لیکن معدودی از مطالعات به طور مستقیم به بررسی وضعیت آلودگی ماده غذایی پرداخته­اند. از آنجا که استافیلوکوکوس اورئوس بیماریزا و مولد انتروتوکسین می­باشد، جستجوی آن در مواد غذایی از جنبه ایمنی و بهداشت بسیار حائز اهمیت است. تکنیک به کار رفته در این مطالعه واجد پتانسیل جستجو و شمارش سلول­های زنده استافیلوکوکوس اورئوس، تمایز میان استافیلوکوکوس اورئوس توکسین­زا و غیر توکسین­زا و نیز جستجوی سویه­های زنده استافیلوکوکوس اورئوس مولد پنج انتروتوکسین شایع استافیلوکوکی (A-E) می­باشد. همچنین، این تکنیک ابزار مناسبی جهت ارزیابی وضعیت آلودگی مواد غذایی به انواع استافیلوکوکوس اورئوس انتروتوکسیژنیک می­باشد. در برخی از مطالعات از اتیدیوم مونوآزید (EMA) جهت تفکیک سلول‎های زنده از مرده استفاده شده است، اما جمع بندی نتایج مطالعات مختلف نشان می‌دهد PMA دارای قدرت نفوذ انتخابی بیشتری به داخل سلول‌های مرده با دیواره سلولی آسیب دیده می‌باشد لیکن EMA علاوه بر سلول‌های مرده می‌تواند به داخل سلول‌های زنده نیز نفوذ نماید (20).

مطابق استاندارد ملی ایران (7)، تعداد استافیلوکوکوس اورئوس در یک دهم گرم شیرینی تر باید صفر باشد. با توجه به اینکه تعداد باکتری برای تولید میزان توکسین مورد نیاز جهت ایجاد مسمومیت غذایی استافیلوکوکی بیشتر از 106 واحد تشکیل دهنده کلنی در گرم می­باشد (7)، حساسیت روش به کار رفته در این مطالعه جهت جستجوی تعداد اندک استافیلوکوکوس اورئوس (کمتر از10 واحد تشکیل دهنده کلنی در گرم) می­باشد قابل ملاحظه به نظر می­رسد. داده­های به دست آمده از qPCR که مجموع سلول‌های مرده و زنده را شمارش نموده است از نتایج دو روش دیگر (کشت معمولی و PMA-qPCR) تعداد بیشتری باکتری را نشان می­دهد.  PMAفاقد توانایی حذف سیگنال­ها از سلول­های زنده می­باشد بدین ترتیب سلول­های مرده با افزودن PMA طی PMA-qPCR شمارش نمی­گردند (22). حساسیت روش PMA-qPCR برای سلول­های مختلف باکتریایی متفاوت است و مطالعات مختلف برای جنس­ها و گونه­های مختلف باکتریایی نتایج متفاوتی را گزارش می­نمایند.

نتایج مطالعه  Kobayashiو همکاران در سال 2009 طی بررسی توانایی  PMAدر تمایز سلول­های سالم از سلول­های مرده استافیلوکوکوس اورئوس و استافیلوکوکوس اپیدرمیس نشان داد که PMA از تولید سیگنال توسط سلول­های آسیب دیده و مرده جلوگیری نموده است و داده­های  qPCRمنعکس کننده تعداد باکتری­های زنده بدون تأثیرپذیری از حضور سلول­های مرده می‌باشد (10).

 Elizaquívelو همکاران در سال 2013 به ارزیابی تأثیر ضدمیکربی اسانس آویشن شیرازی بر باکتری­های اشرشیاکلی O157:H7، سالمونلا انتریکا و لیستریا مونوسیتوژنز در سبزیجات برگی پرداخته و جهت شمارش انتخابی سلول­های زنده از تکنیک PMA-  qPCR استفاده نمودند. نتایج مطالعه ایشان نشان داد که روش فوق به طور کارایی تنها باکتری­های بیماریزای زنده را جستجو می­نماید (4). داده­های به دست آمده در مطالعه حاضر نیز کارایی این تکنیک را در  شمارش سلول­های زنده استافیلوکوکوس اورئوس تائید می­نماید. اما چنانکه پیش­تر ذکر گردید تکنیک  qPCRدر ترکیب با PMAدر مورد همه سلول­های باکتریایی با کیفیت یکسان عمل نمی­کند و در برخی موارد نتایج با نتایج حاصل از کشت معمولی قرابت ندارد.  به طور مثال در مطالعه Azizkhani در سال 2016 تأثیر ضد میکربی اسانس آویشن شیرازی بر باکتری‌های بیماریزای گوشت چرخ شده با استفاده از روش PMA-qPCR مورد ارزیابی قرار گرفت. مطابق نتایج  به دست آمده برای ترکیب‌های مختلف سلول‌های زنده و مرده در گوشت چرخ شده تلقیح شده به طور مصنوعی، تعداد باکتری‌ها در گوشت چرخ­شده 104 × 27/3 واحد تشکیل دهنده کلنی در گرم بود. مقادیر به دست آمده از PMA-qPCR برای سالمونلا انتریکا و اشرشیاکلیO157:H7، با تعداد سلول­های زنده شمارش شده روی پلیت مرتبط بود. لیکن در خصوص لیستریامونوسیتوژنز، تعداد سلول‌های زنده در همه موارد بیشتر از تعداد واقعی تخمین زده شد و برای نمونه حاوی 100 درصد سلول­های مرده، تکنیک PMA-qPCR همچنان وجود 8/3 درصد سلول زنده را نشان می داد (2). احتمال می­رود که تکنیک PMA-qPCR که در خصوص برخی از باکتری­ها با کارایی و اعتمادپذیری بالا عمل  می­کند در مورد برخی دیگر کاربردی نباشد. در این رابطه نتایج مشابهی توسط Lovdal و همکاران در سال  2011 به دست آمد (12). به نظر می­رسد علت این امر تفاوت­های جزیی در دیواره سلولی و گرم مثبت یا گرم منفی بودن باکتری باشد (16).

 Zhangو همکاران در سال 2014، جهت تفکیک سلول­های زنده از مرده و حذف سیگنال­های کاذب حاصل از  DNAسلول­های مرده طی شمارش باکتری باسیلوس سرئوس از روش  PCR multiplex همراه با  PMAاستفاده نمودند. محدوده جستجو برای سلول­های مرده  باسیلوس سرئوس بدون تیمار با PMA در کشت خالص باکتری 102 × 4 واحد تشکیل دهنده کلنی در میلی لیتر، 101 × 5/7  واحد تشکیل دهنده کلنی در میلی لیتر برای سلول­های زنده باسیلوس سرئوس بدون تیمار با  PMAو 101 × 5/7 واحد تشکیل دهنده کلنی در میلی لیتر برای سلول­های زنده باسیلوس سرئوس تیمارشده با  PMAبود. مطابق نتایج این مطالعه روش PCR multiplex در ترکیب با PMA، ابزار ارزیابی سریع، مطمئن و واجد کارایی تشخیصی بالا در کنترل میکربی نمونه­های غذایی می­باشد (22).  Forghaniو همکاران در سال 2015 نیز پژوهشی مشابه جهت شمارش سلول­های زنده باسیلوس سرئوس، سویه­های انتروتوکسین­زا و تهوع­زا، در مواد غذایی انجام دادند. یافته­ها نشان داد که استفاده از PCR در ترکیب با  PMA نتایج قابل اعتماد­تری نسبت به روش معمولی کشت حاصل می­نماید (6). در پژوهش حاضر نیز اختلاف معناداری میان داده­های حاصل از شمارش به روش کشت معمولی و  PMA-qPCR مشاهده نشد.

Zhang و همکاران در سال 2015 از تکنیک PMA-qPCR جهت جستجو و شمارش سلول­های زنده استافیلوکوکوس اورئوس در شیر خشک و محصولات گوشتی تلقیح شده با باکتری‌های استافیلوکوکوس اورئوس، باسیلوس سرئوس و سالمونلا انتریکا استفاده نمودند. نتایج نشان داد که تیمار سلول با  PMA قبل از استخراج  DNAموجب حذف نتایج مثبت کاذب با تاثیر بسیار ناچیز بر سلول­های زنده می­گردد. آستانه جستجو و شمارش در مطالعه ایشان 102 × 0/3 واحد تشکیل دهنده کلنی در گرم شیر خشک بود (21). در حالی که در پژوهش حاضر قدرت جستجو بالاتر بود. ممکنست بالا بودن تعداد و تنوع میکروارگانیسم‌های موجود در نمونه به عنوان عامل مداخله­گر و کاهش­دهنده حساسیت تکنیک عمل نماید. واضح است که انجام مطالعات بیشتری جهت بررسی این مساله نیاز است.

نتیجه گیری: به طور کلی با توجه به نتایج به دست آمده، تکنیک  PMA-qPCRروشی کارآ و سریع جهت شمارش سلول‌های استافیلوکوکوس اورئوس در مواد غذایی می‌باشد. این روش به عنوان ابزار تشخیصی قابل اعتماد و دارای دقت و حساسیت بالا و هزینه نه چندان زیاد قابلیت کاربرد در آنالیز میکربی مواد غذایی و نیز تشخیص­های بالینی را دارد. در کلیه مطالعات انجام شده توسط سایر محققین که پیش­تر به آن‌ها اشاره شد تأثیر بازدارندگی  PMAاز تولید سیگنال توسط سلول­های مرده طی qPCR مورد تأیید قرار گرفته است اما هیچ کدام از این پژوهش­ها روش PMA-qPCR را در نمونه­های بالینی یا غذایی جهت کاربرد واقعی این تکنیک و یا بررسی وجود سویه­های انتروتوکسیژنیک استافیلوکوکوس اورئوس در مواد غذایی عرضه شده در بازار مصرف گزارش ننموده­اند. این مطالعه نخستین کاری است که در راستای اهداف نظارتی و کنترل کیفیت مواد غذایی در سطح وسیع انجام شده و با توجه به مدت زمان کوتاه حصول نتایج و صحت و دقت قابل ملاحظه این روش امید است در آینده نزدیک در آزمایشگاه­های کنترل کیفیت مواد غذایی دستگاه‌های نظارتی به کار گرفته شود.

سپاسگزاری

این طرح تحقیقاتی با استفاده از اعتبارات ویژه پژوهشی (گرنت شماره 437/8/پ) دانشگاه تخصصی فناوری­های نوین آمل انجام گردیده است.

تعارض منافع

بین نویسندگان تعارض در منافع گزارش نشده است.

 

جدول 1. پرایمرهای مورد استفاده جهت بررسی ﻓﺮاواﻧﻲ ژن­ﻫﺎی مولد انتروتوکسین در استافیلوکوکوس اورئوس.

 

نام پرایمر

توالی    (5’à3’)

طول (bp)

مرجع

sea-F

sea–R

ATGGTGCTTATTATGGTTATC

CGTTTCCAAAGGTACTGTATT

120

(12)

seb-F

seb–R

GTATGGTGGTGTAACTGAGC

CCAAATAGTGACGAGTTAGG

164

(13)

sec-F

sec–R

TTTTTGGCACATGATTTAATTT

CAACCGTTTTATTGTCGTTG

257

(12)

sed-F

sed–R

CCAATAATAGGAGAAAATAAAAG

ATTGGTATTTTTTTTCGTTC

 

(13)

see-F

see–R

CAGTACCTATAGATAAAGTTAAAACAAGC

TAACTTACCGTGGACCCTTC

178

(12)

16S rRNA-F

16S rRNA –R

GCTGCCCTTTGTATTGTC

AGATGTTGGGTTAAGTCCC

278

(14)

 

 

 

 

 

 

 

جدول 2. نتایج شمارش استافیلوکوکوس اورئوس (لگاریتم واحدهای تشکیل دهنده کلنی در گرم) در نمونه­های شیرینی به روش کشت معمولی، qPCR و PMA-qPCR.

 

زمان نمونه گیری

کشت معمولی

qPCR

PMA-qPCR

هفته اول

a*25/0±7/2

b16/0±2/3

a27/0±81/2

هفته دوم

a18/0±85/2

b23/0±71/3

a24/0±78/2

هفته سوم

a31/0±65/2

b15/0±52/3

a19/0±72/2

هفته چهارم

a12/0±83/2

b35/0±91/3

a32/0±9/2

هفته پنجم

a19/0±91/1

b21/0±77/2

a15/0±85/1

هفته ششم

a3/0±80/1

b26/0±69/2

a21/0±91/1

هفته هفتم

a22/0±59/2

b13/0±82/3

a35/0±63/2

هفته هشتم

a17/0±75/2

b20/0±91/2

a11/0±84/2

 

*حروف انگلیسی در هر سطر نشان دهنده تفاوت معنادار بین داده­های آن سطر می باشد(05/0>P).

 

جدول 3. نتایج شمارش استافیلوکوکوس اورئوس انتروتوکسیژنیک (لگاریتم واحدهای تشکیل دهنده کلنی در گرم) در نمونه­های شیرینی به روش qPCR و PMA-qPCR.

 

نوع انتروتوکسین

PMA-qPCR

qPCR

SEA

a*11/0±72/1

b16/0±03/1

SEB

0

0

SEC

a2/0±85/1

b14/0±2/1

SED

a19/0±65/0

b08/0±11/0

SEE

a15/0±37/1

b04/0±90/0

فاقد انتروتوکسین

a18/0±05/2

a13/0±53/1

*حروف انگلیسی در هر سطر نشان دهنده تفاوت معنادار بین داده­های آن سطر می باشد (005/0>P).

 

 

References
 
  1. Akinedan, O., Hassan, A.A., Schneider, E., Usleber, E. (2008). Entrotoxigenic properties of Staphylococcus aureus isolated from goat's milk cheese. Int J Food Microbiol, 124(2), 211-216. https://doi.org/10.1016/j.ijfoodmicro.2008.03.027 PMID: 18455257
  2. Azizkhani, M. (2016). Evaluation of antimicrobial effect of Zataria multiflora Boiss. essential oil on food-borne pathogens in minced beef combining real time-PCR and propidium monoazide. J Food Process Preserv, 7, 97-118.
  3. Azizkhani, M., Misaghi, A., Basti, A.A., Gandomi, H.,  Hosseini, H. (2013). Effects of Zataria multiflora Boiss. essential oil on growth and gene expression of enterotoxins A, C and E in Staphylococcus aureus ATCC 29213. Int J Food Microbiol, 166, 249–255. https://doi.org/10.1016/j.ijfoodmicro.2013.02.020 PMID: 23558199
  4. Elizaquível, P., Azizkhani, M., Sánchez, G., Aznar, R. (2013). Evaluation of Zataria multiflora Boiss. essential oil activity against Escherichia coli O157:H7, Salmonella enterica and Listeria monocytogenes by propidium monoazide quantitative PCR in vegetables. Food Control, 34, 770-776.  https://doi.org/10.1016/j.foodcont.2013.06.036
  5. Elizaquivel, P., Sanchez, G., Aznar, R. (2012). Quantitative detection of viable foodborne E. coli O157:H7, Listeria monocytogenes and Salmonella in fresh-cut vegetables combining propidium monoazide and real-time PCR. Food Control, 25, 704-708. https://doi.org/10.1016/j.foodcont.2011.12.003
  6. Forghani, F., Langaee, T., Eskandari, M., Seo, K.H., Chung, M.J., Oh, D.H. (2015). Rapid detection of viable Bacillus cereus emetic and enterotoxic strains in food by coupling propidium monoazide and multiplex PCR (PMA-mPCR). Food Control, 55, 151-157.  https://doi.org/10.1016/j.foodcont.2015.02.049
  7. Iranian Standard of microbiological characteristics of Pastry products (No 2395). (1993). Institute of Standards and Industrial Research of Iran. Tehran, Iran.
  8. Jay, J.M., Loessner, M.J., Golden, D.A. (2005). Modern Food Microbiology. (7th ed.). Springer. New York, USA. p. 531.
  9. Josefsen, M.H., Lofstrom, C., Hansen, T.B., Christensen, L.S., Olsen, J.E., Hoorfar, J. (2010). Rapid quantification of viable Campylobacter bacteria on chicken carcasses, using real time PCR and propidiummonoazide treatment, as a tool for quantitative risk assessment. Appl Environ Microbiol,76(15), 5097-5104. https://doi.org/10.1128/AEM.00411-10 PMID: PMC2916463 
  10. Kobayashi, H., Oethinger, M., Tuohy, M.J., Hall, G.S., Bauer, T.W. (2009). Improving clinical significance of PCR: use of propidium monoazide to distinguish viable from dead Staphylococcus aureus and Staphylococcus epidermidis. J Orthop Res, 27(9), 1243-1247. https://doi.org/10.1002/jor.20872 PMID: 19322790
  11. Kramer, M., Obermajer, N., Bogovic, M.B., Rogelj, I., Kmetec, V. (2009). Quantification of live and dead probiotic bacteria in lyophilised product by real-time PCR and by flow cytometry. Appl Microbiol Biotechnol, 84(6), 1137-1147.   https://doi.org/10.1007/s00253-009-2068-7 PMID: 19529931 
  12. Lovdal, T., Hovda, M. B., Bjorkblom, B., Moller, S. G. (2011). Propidium monoazide combined with real-time quantitative PCR underestimates heat-killed Listeria innocua. J Microbiol Method, 85(2), 164-169. https://doi.org/10.1016/j.mimet.2011.01.027 PMID: 21324348 
  13. Mehrotra, M., Wang, G., Johnson, W.M. (2000). Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J Clin Microbiol, 38(3), 1032–1035. PMID: 10698991 
  14. Nocker, A., Cheung, C. Y., Camper, A. K. (2006). Comparison of propidium monoazidewith ethidium monoazide for differentiation of live vs. dead bacteria by selective removal of DNA from dead cells. J Microbiol Method,67(2), 310-320.  https://doi.org/10.1016/j.mimet.2006.04.015 PMID: 16753236  
  15. Nocker, A., Mazza, A., Masson, L., Camper, A. K., Brousseau, R. (2009). Selective detection of live bacteria combining propidium monoazide sample treatment with microarray technology. J Microbiol Method, 76(3), 253-261.  https://doi.org/10.1016/j.mimet.2008.11.004
  16. Nogva, H. K., Dromtorp, S., Nissen, H., Rudi, K. (2003). Ethidium monoazide for DNA-based differentiation of viable and dead bacteria by 50-nuclease PCR. Bio Technol, 34(4), 804-813. https://doi.org/10.2144/03344rr02 PMID: 12703305
  17. Pan,Y., Breidt, F., J. (2007). Enumeration of viable Listeria monocytogenes cells by realtime PCR with propidium monoazide and ethidium monoazide in the presence of dead cells. Appl Environ Microbiol, 73(24), 8028-8031. https://doi.org/10.1128/AEM.01198-07 PMID: 17933922  
  18. Qiu, J., Feng, H., Xiang, H., Wang, D., Xia, L., Jiang, Y., Song, K., Lu, J., Yu, L., Deng, X. (2010). Infuence of subinhibitory concentrations of licochalcone A on the secretion of enterotoxins A and B by Staphylococcus aureus. FEMS Microbiol Lett, 307, 135–141. https://doi.org/10.1111/j.1574-6968.2010.01973.x PMID: 20412304
  19. Rudi, K., Nogva, H. K., Moen, B., Nissen, H., Bredholt, S., Moretro, T., Naterstad, K., Holck, A. (2002). Development and application of new nucleic acid-based technologies for microbial community analyses in foods. Int J Food Microbiol, 78, 171-180. https://doi.org/10.1016/s0168-1605(02)00236-2  PMID: 12222632
  20. Yáñez, M.A., Nocker, A., Soria-Soria, E., Múrtula, R., Martínez, L., Catalán, V. (2011). Quantification of viable Legionella pneumophila cells using propidium monoazide combined with quantitative PCR. J Microbiol Method, 85, 124–130. https://doi.org/10.1016/j.mimet.2011.02.004 PMID: 21329735  
  21. Zhang, Z., Liu, W., Xu, H., Aguilar, Z.P., Shah, N.P., Wei, H. (2015). Propidium monoazide combined with real-time PCR for selective detection of viable Staphylococcus aureus in milk powder and meat products. J Dairy Sci, 98(3), 1625-1633. https://doi.org/10.3168/jds.2014-8938 PMID: 25582587  
  22. Zhang, Z., Wang, Z., Xu, H., Zoraida, P., Aguilar, C., Liu, C., Gan, B., Xiong, Y., Lai, W., Xu, F., Wei, H.  (2014). Detection of non-emetic and emetic Bacillus cereus by propidium monoazide multiplex PCR (PMA-mPCR) with internal amplification control. Food Control, 35, 401-406. https://doi.org/10.3168/jds.2014-8938