شیوع سرمی و مطالعه مولکولی آلودگی به توکسوپلاسما در مرغ‌های بومی شهرستان خرم‌آباد، ایران

نوع مقاله: انگل شناسی و بیماری های انگلی

نویسندگان

1 دانش آموخته انگل‌شناسی، دانشکده دامپزشکی دانشگاه لرستان، خرم‌آباد، ایران

2 گروه پاتوبیولوژی، دانشکده دامپزشکی دانشگاه لرستان، خرم‌آباد، ایران

3 گروه علوم درمانگاهی، دانشکده دامپزشکی دانشگاه لرستان، خرم‌آباد، ایران

چکیده

زمینۀ مطالعه: توکسوپلاسما گوندی یک انگل تک‌یاخته‌ای و داخل سلولی است که قادر به آلوده کردن اکثر جانوران خونگرم از جمله انسان و پرندگان است. با توجه به عادات تغذیه‌ای در مرغ‌های بومی، شیوع آلودگی به توکسوپلاسمادر مرغ‌های با پرورش آزاد به عنوان یک شاخص مناسب از پراکنش اُاُسیست‌‌ها در محیط مطرح است.
هدف: مطالعه حاضر با هدف بررسی شیوع سرمی آلودگی به توکسوپلاسمادر مرغ‌های بومی شهرستان خرم‌آباد و مقایسه نتایج حاصل از روش‌های سرمی و مولکولی طراحی گردید.
روش‌کار: در مجموع 97 نمونه سرم به صورت تصادفی از مرغ‌های بومی اخذ گردید و با استفاده از آزمون آگلوتیناسیون تعدیل ‌یافته (MAT) از نظر حضور پادتن‌های ضد توکسوپلاسما بررسی گردیدند. پنجاه گرم عضله (ترکیب عضلات قلب و سینه) و کل مغز مرغ‌های سرم مثبت به طور مجزا هموژنیزه گردید و با انجام PCR توالی تکرارشوندهتوکسوپلاسما (RE) ردیابی شد.
نتایج: پادتن‌های ضد توکسوپلاسمادر 21 از 97 نمونه سرم (64/21 درصد) مشاهده گردید. از بین 21 پرنده سرم مثبت در 10 پرنده (61/47 درصد) DNA توکسوپلاسما گوندی ردیابی گردید (با عیار سرمی ≥20:1). تطابق اندک بین نتایج سرمی و مولکولی احتمالاً با برخی عوامل از جمله امکان واکنش‌های متقاطع در آزمون MAT و یا مقدار محدود نمونه در آزمون PCR مرتبط است.
نتیجه‌گیری نهایی: این نتایج بر اهمیت نقش مرغ‌های بومی به عنوان یک منبع عفونت برای گربه‌ها و افراد ساکن در مناطق روستایی دلالت دارد.

کلیدواژه‌ها


عنوان مقاله [English]

Seroprevalence and Molecular Study of Toxoplasma Infection in Domestic Chickens from Khorramabad, Iran

نویسندگان [English]

  • Seyed Foad Ahmadi 1
  • Ozra Zarifi 1
  • Hamidreza Shokrani 2
  • Hassan Norouzian 3
1 Graduated from the Parasitology, Faculty of Veterinary Medicine, Lorestan University, Khorramabad, Iran
2 Department of Pathobiology, Faculty of Veterinary Medicine, Lorestan University, Khorramabad, Iran
3 Department of Clinical Sciences, Faculty of Veterinary Medicine, Lorestan University, Khorramabad, Iran
چکیده [English]

BACKGROUND: Toxoplasma gondii is an intracellular protozoan parasite that can infect most species of warm-blooded animals, including birds and humans. Because of feeding habits of domestic chickens, prevalence of Toxoplasma infection in free-range chickens is considered as a suitable indicator of environmental distribution of oocysts.
OBJECTIVES: The present study was designed to investigate the seroprevalence of Toxoplasma infection in domestic chickens from Khorramabad and compare the results obtained from serological and molecular methods.
METHODS: In total, 97 serum samples were randomly obtained from domestic chickens and examined for the presence of anti-Toxoplasmaantibodies using modified agglutination test (MAT). Fifty grams of muscles (mixture of breast and heart) and whole brain from seropositive chickens were separately homogenized and examined by PCR which targets the repeated element (RE) of the parasite.
RESULTS: Anti-Toxoplasma antibodies were observed in 21 of 97 (21.64%) sera. T. gondii DNA was detected in 10 out of 21 (47.61%) seropositive chickens (with titres of ≥1:20). The low agreement between serological and molecular results can be explained by several factors such as possibility of cross-reactions in MAT and/or limited sample size in PCR.
CONCLUSIONS: These results indicate that domestic chickens may have an important role as a source of infection for cats and individuals living in rural areas.

کلیدواژه‌ها [English]

  • Toxoplasma
  • Domestic chickens
  • Seroprevalence
  • Tissue sample
  • PCR

مقدمه


توکسوپلاسما گوندی انگل کوکسیدیایی با انتشار جهانی وسیع است. بیماری حاصل از این انگل یکی از مهمترین بیماری‌های مشترک انسان و دام است. گربه و گربه‌سانان عمدتاً از طریق خوردن لاشۀ پرندگان و یا پستانداران کوچک آلوده می‌شوند و با دفع میلیون‌ها اُاُسیست منجر به آلوده شدن آب، خاک، علوفه و سبزیجات می‌گردند. پرندگان اُاُسیست‌های اسپروله‌شده انگل را از بستر یا خاک دریافت می‌نمایند و پس از یک فاز کوتاه و حاد، کیست‌های نسجی در بافت‌های مختلف نظیر مغز، قلب، عضلات اسکلتی، کلیه، کبد، طحال، ریه، سنگدان، تخمدان، روده و چشم تشکیل می‌شوند (1).

توکسوپلاسموزیس در برخی پرندگان با ضایعاتی چون بزرگ‌شدن پریکارد و میوکارد، زخم روده، پنومونی و نکروز کبد و طحال همراه است. ماکیان به توکسوپلاسموزیس بالینی مقاوم هستند و تنها موارد معدودی از توکسوپلاسموزیس بالینی در این پرندگان گزارش شده است. بی‌اشتهایی، لاغری، کاهش تولید تخم، عدم تعادل و کوری از مهمترین علائم توکسوپلاسموزیس در ماکیان است (1). ماکیان بومی نقش مهمی در اپیدمیولوژی توکسوپلاسما درمحیط‌های روستایی دارند و به عنوان یک منبع عفونت برای انسان و همچنین به عنوان یک مخزن آلودگی برای گربه‌ها مطرح هستند (6).

امروزه از آزمون‌های سرمی مختلف به منظور ردیابی پادتن‌های اختصاصی ضد توکسوپلاسما استفاده می‌شود. جهت انجام مطالعات اپیدمیولوژیک با هدف غربالگری در پستانداران و پرندگان، آزمون آگلوتیناسیون تعدیل ‌یافته (Modified agglutination test) رواج دارد (15). همچنین با توجه به ویژگی و حساسیت بالای روش‌های مولکولی، کاربرد واکنش زنجیره‌ای پلی‌مراز (PCR) به منظور ردیابی DNA توکسوپلاسما در نمونه‌های بافتی افزایش یافته است. مطالعه حاضر با هدف بررسی شیوع سرمی توکسوپلاسما گوندی در مرغ‌های بومی شهرستان خرم‌آباد و همچنین مقایسه نتایج حاصل از آزمون‌‌های MAT و PCR انجام گردید.

مواد و روش‌کار

جمع‌آوری نمونه: طی مدت یک ماه، با مراجعه به تعدادی از روستاهای شهرستان خرم‌آباد، از 97 قطعه مرغ بومی با پرورش آزاد خون‌گیری گردید. پرندگان به صورت تصادفی انتخاب و پلاک‌گذاری شدند. همزمان اطلاعات مربوط به مکان و زمان نمونه‌گیری و مشخصات پرنده ثبت گردید. بدنبال انجام آزمون MAT، تمامی پرندگان دارای عیار سرمی مثبت خریداری شدند و در آزمایشگاه نمونه‌گیری از بافت مغز و عضلات قلب و سینه انجام گردید. نمونه‌های بافتی تا زمان انجام آزمایشات مولکولی در منفی 20 درجه سانتیگراد نگهداری شدند.

آزمون آگلوتیناسیون تعدیل‌ یافته (MAT): اساس آزمون MAT، آگلوتیناسیون پادگن و پادتن در مجاورت 2-مرکاپتواتانول است. تراکم مناسب تاکی‌زوئیت‌ها جهت انجام این آزمایش 107 عدد در هر میلی‌لیتر است (16). در این مطالعه از تاکی‌زوئیت‌های توکسوپلاسما (کشته شده در فرمالین؛ انستیتو پاستور ایران) به عنوان پادگناستفاده شد. به منظور جدا کردن سرم،‌ نمونه‌ها با دور 2000 و به مدت 10 دقیقه سانتریفوژ شدند. سپس سرم‌ها به روش رقیق‌سازی سریالی و با استفاده از بافر فسفات سالین (1x, pH 7.2) تا هشت چاهک رقیق شدند. بر اساس مطالعات پیشین عیارهای 10:1 و بالاتر به عنوان عیار مثبت در نظر گرفته شدند (11). تهیه سوسپانسیون حاوی پادگن مطابق دستورالعمل شرح داده شده توسط Dubey و Desmonts در سال 1987 انجام گردید (7). به هر چاهک 25 میکرولیتر سرم رقیق‌‌شده و 25 میکرولیتر سوسپانسیون حاوی پادگن اضافه گردید. پلیت‌ها (96 خانه با چاهک‌های U شکل) به مدت 12 ساعت در انکوباتور با دمای 37 درجه سانتیگراد نگهداری شدند. مشاهده آگلوتیناسیون بصورت یک شبکه در کف چاهک به منزله نتیجه مثبت و آخرین چاهکی که آگلوتیناسیون را نشان داد به عنوان عیار سرم در نظر گرفته شد.

استخراج DNA: نمونه‌های بافتی پرندگان شامل نمونه‌های مغز و عضله (میکس عضلات قلب و سینه) به صورت مجزا هموژنیزه شدند و با استفاده از نیتروژن مایع به صورت پودر در آمدند. استخراج DNA با استفاده از کیت‌ تجاری شرکت MBST ایران انجام شد. بدین منظور به تیوب‌های حاوی نمونه، 180 میکرولیتر بافر تجزیه کننده و 20 میکرولیتر پروتئیناز K اضافه شد. نمونه‌ها پس از ورتکس در دمای 55 درجه سانتیگراد به مدت یک شب نگهداری شدند تا به طور کامل هضم گردند. سایر مراحل مطابق دستورالعمل شرکت سازنده کیت انجام شد. درنهایت محلول جمع‌آوری شده جهت آنالیز نهایی در منفی 20 درجه سانتیگراد نگهداری گردید.

واکنش زنجیره‌ای پلیمراز (PCR): به منظور تشخیص آلودگی به توکسوپلاسمادر نمونه‌های بافتی، توالی اختصاصی (RE) به طول  529جفت‌باز تکثیر گردید. بدین منظور از پرایمرهای Tox4 (CGCTGCAGGGAGGAAGACGAAAGTTG) و Tox5 (CGCTGCAGACACAGTGCATCTGGATT) استفاده شد (2،14).

در هر واکنش از پرایمرهای Tox4 وTox5  (شرکت سیناژن) هر یک 5/0میکرومولار، PCR Master mix (شرکت سیناژن) به میزان 5/12 میکرولیتر و نمونه DNA به میزان 1 میکرولیتر استفاده شد و حجم نهایی با آب مقطر به 25 میکرولیتر رسید. در تمام واکنش‌ها از آب مقطر به عنوان کنترل منفی و از DNA توکسوپلاسماسویه RH (انستیتو پاستور ایران) به عنوان کنترل مثبت استفاده شد.

واکنش PCR با استفاده از دستگاه ترموسایکلر Bio-Rad MyCycler و با شرایط دمایی و زمانی واسرشــت اولیه: 94 درجه سانتیگراد به مدت 7 دقیقه؛ 33 سیکل شامل واسرشــت: 94 درجه سانتیگراد به مدت 60 ثانیه، اتصال: 5/58 درجه سانتیگراد به مدت 45 ثانیه، تکثیر: 72 درجه سانتیگراد به مدت 60 ثانیه؛ تکثیر نهایی: 72 درجه سانتیگراد به مدت 10 دقیقه انجام گردید. جهت بررسی محصول PCR از ژل آگاروز 5/1 درصد در بافر 0.5x TBE استفاده شد.

نتایج

از 97 پرنده مورد مطالعه در 21 مورد (64/21 درصد) پادتن‌های ضد توکسوپلاسما شناسایی گردید. در بین پرندگان آلوده فراوان‌ترین عیار سرمی 20:1 بود که در 09/38 درصد از نمونه‌‌‌‌‌‌‌‌‌‌های مثبت مشاهده شد. بالاترین عیار سرمی 640:1 بود که تنها از یک پرنده گزارش شد (جدول 1).

در بین پرندگان دارای عیار سرمی مثبت، در 10 پرنده (61/47 درصد) عفونت بافتی به توکسوپلاسماشناسایی گردید (تصویر 1).  از مجموع 42 نمونه بافتی، در 14 نمونه (33/33 درصد) DNA توکسوپلاسما گوندی ردیابی شد (جدول 2). میزان آلودگی در بافت مغز بیشتر بود هر چند این اختلاف از نظر آماری معنی‌دار نبود. در 4 پرنده آلودگی توأم در هر دو بافت (مغز و عضله) مشاهده شد.

بحث

توکسوپلاسما گوندی در بسیاری از پرندگان اهلی و وحشی گزارش شده است. شیوع توکسوپلاسمادر مرغداری‌های صنعتی اندک است لذا خطر انتقال آلودگی به انسان از طریق مصرف گوشت این پرندگان ناچیز است. آلودگی به توکسوپلاسمادر ماکیان بومی با پرورش آزاد اهمیت دارد. با توجه به نحوه تغذیه ماکیان بومی، شیوع توکسوپلاسمادر این گروه از ماکیان شاخص مهمی از میزان پراکندگی اُاُسیست‌ها در محیط است. همچنین مصرف گوشت این پرندگان به صورت خام یا نیم‌پز می‌تواند منجر به ظهور عفونت در انسان شود. با این حال احتمال انتقال آلودگی بدنبال مصرف تخم‌ مرغ خام بسیار ضعیف است (6،11).

تشخیص قطعی توکسوپلاسموزیس در پرندگان از طریق معاینات بالینی امکان‌پذیر نیست لذا از آزمون‌های سرمی به منظور ردیابی پادتن‌های اختصاصی ضدتوکسوپلاسما و یا پادگن‌های انگل در مایعات بدن استفاده می‌شود. آزمون MAT یکی از کارآمدترین آزمون‌های سرمی در تشخیص ایمونوگلوبولین‌های G اختصاصی ضد توکسوپلاسما در سرم حیوانات مشکوک است (4،5). نتایج مطالعه حاضر نشان داد شیوع سرمی توکسوپلاسما گوندی در مرغ‌های بومی شهرستان خرم‌آباد 64/21 درصد است. در مطالعات پیشین شیوع پادتن‌های ضد توکسوپلاسمادر ماکیان با استفاده از آزمون‌ MAT از 2 تا 100 درصد گزارش شده است (6). این تفاوت احتمالاً ناشی از اختلاف در شرایط اقلیمی، میزان فراوانی گربه به عنوان میزبان نهایی و همچنین تفاوت در سطح cut-off است. شیوع سرمی آلودگی بهتوکسوپلاسمادر مرغ‌های بومی با پرورش آزاد با استفاده از آزمون MAT در مصر (2005) در بین 150  نمونه 7/18 درصد؛ در ویتنام (2008) در بین 330 نمونه 2/24 درصد؛ در پرو (2004) در بین 50 نمونه 26 درصد؛ در اندونزی (2008) در بین 90 نمونه 6/26 درصد و در پرتغال (2006) در بین 225 نمونه 01/27 درصد گزارش شده است (6).

در این مطالعه فراوان‌ترین عیار پادتن‌های ضدتوکسوپلاسما 1:20 بوده است. میزان تشکیل پادتن‌ها به عوامل مختلفی از جمله سویه و حدت انگل، شدت آلودگی و همچنین مرحله تکاملی آن وابسته است. پادتن IgG معمولاً 1 تا 2 هفته بعد از کسب عفونت ظاهر می شود و در 6 تا 8 هفته بعد از عفونت به حداکثر میزان خود می‌رسد. بدنبال جایگزین شدن انگل در بافت‌های عصبی و عضلانی، سیستم ایمنی کمتر تحریک می‌شود و عیار پادتن در این مرحله کمتر است (10). با توجه به اینکه در این مطالعه تمام پرندگان بالغ بوده‌اند به نظر می‌رسد آلودگی قدیمی بوده و مربوط به ماه‌های گذشته است با این حال این احتمال نیز وجود دارد که تعدادی از این پرندگان در ابتدای عفونت بوده‌اند. در مطالعه‌ای در مصر El-Massry و همکاران در سال 2000 با انجام آزمون MAT بر روی 108 مرغ بومی فراوان‌ترین عیار پادتن‌های ضدتوکسوپلاسما را 1:20 گزارش کردند (9). Dubey و همکاران در سال 2005 نیز در اتریش با انجام آزمون MAT بر روی830 قطعه مرغ بومی با پرورش آزاد، فراوان‌ترین عیار سرمی را 1:20 گزارش نمودند (8).

مطالعات اخیر نشان داده‌ است آزمون PCR یک روش حساس جهت تشخیص DNAتوکسوپلاسما در شرایط بالینی و مطالعات اپیدمیولوژیک است. جهت شناسایی توکسوپلاسما از ژن‌های B1، SAG1، 3´SAG2، 5´SAG2، SAG3، ITS1 و همچنین قطعه‌ 529 جفت بازی (RE) استفاده شده است. در مطالعه حاضر بدنبال ردیابی توالی RE، از بین 21 پرنده دارای عیار سرمی مثبت در 10 مورد (61/47 درصد)، DNA توکسوپلاسما گوندی ردیابی شد. در اکثر مطالعات پیشین شیوع سرمی توکسوپلاسما در مقایسه با میزان ردیابی انگل با استفاده از روش‌های مولکولی بیشتر بوده است. در آزمون‌های سرمی نظیر MAT، به علت امکان واکنش‌های متقاطع، نتایج مثبت کاذب محتمل است. از طرفی در آزمون PCR با توجه به تعداد کم کیست‌های نسجی و توزیع تصادفی آن‌ها، مقدار کم نمونه به عنوان عاملی محدودکننده مطرح است (12،13). در مطالعه‌ای در کشور تونس از بین 40 مرغ با عیار سرمی مثبت تنها در 15 مورد (5/37 درصد) DNA انگل ردیابی شد (3). Holsback و همکاران در سال 2012 در برزیل 40 مرغ با پرورش آزاد را از نظر آلودگی به توکسوپلاسما بررسی کردند. نتایج این مطالعه نشان داد 5/67 درصد پرندگان دارای عیار سرمی مثبت هستند با این حال ژن B1 تنها در 40 درصد از پرندگان ردیابی شد (13). Hamidinejat و همکاران در سال 2014 نیز در اهواز 106 مرغ بومی را از نظر آلودگی به توکسوپلاسما بررسی کردند و میزان آلودگی را با استفاده از آزمون‌های MAT و PCR به ترتیب 89/51 درصد و 23/46 درصد گزارش نمودند (11).

در مناطق روستایی مرغ‌های بومی با پرورش آزاد معمولاً در منزل و یا در مکان‌های فاقد نظارت کشتار می‌شوند و بافت‌های‌ غیرمصرفی این پرندگان در محیط رها شده و یا به صورت غیر بهداشتی دفع می‌گردند. دسترسی راحت گربه‌های ولگرد به این بافت‌ها و عدم شستشوی دست‌ها بدنبال ذبح و خرد کردن گوشت این پرندگان از جمله مواردی هستند که ممکن است در گسترش توکسوپلاسموزیس در جوامع روستایی نقش داشته باشند. به نظر می‌رسد اهمیت مرغ‌های بومی در اپیدمیولوژی توکسوپلاسما گوندی در مناطق روستایی بیشتر از جوندگان است زیرا این پرندگان به عنوان مخزن آلودگی برای گربه‌ها در برابر توکسوپلاسموزیس بالینی مقاوم بوده و طول عمر بیشتری دارند (6).

بر‌اساس نتایج مطالعه حاضر میزان آلودگی ماکیان بومی شهرستان خرم‌آباد به توکسوپلاسما گوندی قابل توجه است لذا به نظر می‌رسد اجرای اقدامات پیشگیرانه و آموزش همگانی جهت رعایت اصول بهداشتی در نگهداری و مصرف ماکیان بومی ضرورت دارد.

سپاسگزاری

این مقاله مستخرج از پایان‌نامه‌های کارشناسی‌ارشد رشته انگل‌شناسی بوده و با حمایت مالی معاونت پژوهشی دانشگاه لرستان به انجام رسیده است. نویسندگان بر خود لازم می‌دانند از استاد گرامی جناب آقای دکتر حسین حمیدی‌نجات جهت مشاوره و رفع برخی نواقص قدردانی نمایند.

تعارض منافع

بین نویسندگان تعارض در منافع گزارش نشده است.

جدول 1. نتایج آزمون آگلوتیناسیون تعدیل ‌یافته (MAT): عیار پادتن‌های ضد توکسوپلاسما در ماکیان بومی خرم‌آباد.

عیار سرم

نمونه مثبت

درصد از نمونه‌های مثبت

درصد  از کل

1:10

5

8/23

15/5

1:20

8

09/38

25/8

1:40

5

8/23

15/5

1:80

1

77/4

03/1

1:160

1

77/4

03/1

1:320

0

0

0

1:640

1

77/4

03/1

1:1280

0

0

0

جمع

21

100

64/21

جدول 2. نتایج PCR نمونه­های بافتی ماکیان دارای عیار سرمی مثبت.

بافت

آلوده

غیر آلوده

جمع

تعداد

درصد

تعداد

درصد

مغز

8

1/38

13

9/61

21

عضله*

6

57/28

15

43/71

21

جمع

14

33/33

28

66/66

42

* میکس عضلات قلب و سینه.

تصویر 1. الکتروفورز محصولات PCR به منظور ردیابی توالی اختصاصی توکسوپلاسما گوندی (RE) در نمونه‌های بافتی ماکیان دارای عیار سرمی مثبت. :M مارکر DNA (100 جفت‌باز)؛ C1: کنترل منفی (آب مقطر)؛ C2: کنترل مثبت (سویه RH)؛ ستون‌های 1، 2 و 3: نمونه‌های منفی؛ ستون‌های 4، 5، 6 و 7: نمونه‌های مثبت که باند مورد انتظار (529 جفت‌باز) را نشان داده‌اند.

 

  1. Asgari, Q., Akrami Mohajeri, F., Kalantari, M., Esmaeilzadeh, B., Farzaneh, A., Moazeni, M., Ghalebi, S.R., Saremi, F., Zarifi Kalyani, M., Motazedian, M.H. (2008). Chicken toxoplasmosis in different types of breeding: A seroprevalence survey in southern Iran. Int J Poult Sci, 7, 1247-1250. https:// doi.org/10.3923/ijps.2008.1247.1250
  2. Bezerra, R.A., Carvalho, F.S., Guimarães, L.A., Rocha, D.S., Silva, F.L., Wenceslau, A.A., Alburquerque, G.R. (2012). Comparasion of methods for detection of Toxoplasma gondii in tissues of naturally exposed pigs. Parasitol Res, 110, 509–514. https://doi.org/10.1007/s00436-011-2514-1
  3. Boughattas, S., Bouratbine, A. (2015). Genetic characterization of Toxoplasma gondii isolated from chickens meats in Tunisia. J Food Qual Hazards Control, 2, 99-100.
  4. Desmonts, G., Remington, J.S. (1980). Direct Agglutination Test for diagnosis of Toxoplasma infection: Method for increasing sensitivity and specificity. J Clin Microbiol, 11, 562-568. PMID: 7000807
  5. Dubey, J.P. (2002). A review of toxoplasmosis in wild birds. Vet Parasitol, 106, 121-153. https://doi.org/10.1016/S0304-4017(02)00034-1 PMID: 12031816
  6. Dubey, J.P. (2010). Toxoplasma gondii infections in chickens (Gallus domesticus): prevalence, clinical disease, diagnosis and public health significance. Zoonoses Public Health, 57, 60-73. https://doi.org/10.1111/j.1863-2378.2009.01274.x PMID: 19744 305
  7. Dubey, J.P., Desmonts, G. (1987). Serological responses of equids fed Toxoplasma gondii oocysts. Equine Vet Med J, 19, 337-339. https://doi.org/10.1111/j.2042-3306.1987.tb01426.x PMID: 3622463
  8. Dubey, J.P., Edelhofer, R., Marcet, P., Vianna, M.C.B., Kwok, O.C.H., Lehmann, T. (2005). Genetic and biologic characteristics of Toxoplasma gondii infections in free-range chickens from Austria. Vet Parasitol, 133, 299–306. https:// doi.org/10.1016/j.vetpar.2005.06.006 PMID: 16039065
  9. El-Massry, A., Mahdy, O.A., El-Ghaysh, A., Dubey, J.P. (2000). Prevalence of Toxoplasma gondii antibodies in sera of turkeys, chickens, and ducks from Egypt. J Parasitol, 86, 627-628. https://doi.org/10.1645/0022-3395(2000)086[0627:POTGAI]2.0. CO;2 PMID: 10864268
  10. Gharavi, M.J., Jalali, S., Khademvatan, S., Heydavi, S. (2012). Serological evaluation of anti-toxoplasma IgM and IgG antibodies in renal transplant recipients before and after transplant by ELFA, ELISA and ISAGA methods. Koomesh, 13, 177-182.
  11. Hamidinejat, H., Nabavi, L., Mayahi, M., Ghourbanpoor, M., Pourmehdi Borojeni, M., Norollahi Fard, S., Shokrollahi, M. (2014). Comparison of three diagnostic methods for the detection of Toxoplasma gondii in free range chickens. Trop Biomed, 31, 507-513. PMID: 25382478
  12. Hill, D.E., Chirukandoth, S., Dubey, J.P., Lunney, J.K., Gamble, H.R. (2006). Comparison of detection methods for Toxoplasma gondii in naturally and experimentally infected swine. Vet Parasitol, 141, 9-17. https://doi.org/10.1016/j.vetpar.2006.05.008 PMID: 16815636
  13. Holsback, L., Pena, H.F.J., Ragozo, A., Lopes, E.G., Gennari, S.M., Soares, R.M. (2012). Serologic and molecular diagnostic and bioassay in mice for detection of Toxoplasma gondii in free ranges chickens from Pantanal of Mato Grosso do Sul. Pesq Vet Bras, 32, 721-726. http://dx.doi.org/10.1590/S0100-736X2012000800007
  14. Homan, W.L., Vercammen, M., De Braekeleer, J., Verschueren H. (2000). Identification of a 200 to 300 fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR. Int J Parasitol, 30, 69-75. https://doi.org/10.1016/S0020-7519(99)00170-8 PMID: 10675747
  15. Silva, D.V., Marques, J.M., Corrêa, N.A.B., Velasquez, L.G., Silva, R.C.L, Von Söhsten, A.L., Silva, A.V. (2012). Evaluation of modified agglutination test and enzyme-linked immunosorbent assay in detection of Toxoplasma gondii antibody in human sera. Arq Ciênc Saúde UNIPAR, 16, 17-20.
  16. Sucilathangam, G., Palaniappan, N., Sreekumar, C., Anna, T. (2012). Seroprevalence of Toxoplasma gondii in Immunocompetent and Immunocompromised Patients Using IgG-Modified Direct Agglutination Test (IgG MAT). J Medical Microbiol Diagnosis, 1, 1-5. https://doi.org/10.4172/ 2161-0703.1000102