کلونینگ و بررسی بیان ژن کد‌کننده کاتپسین L کنه ریپی‌سفالوس آنولاتوس

نوع مقاله: انگل شناسی و بیماری های انگلی

نویسندگان

1 گروه انگل شناسی، دانشکده دامپزشکی دانشگاه تهران، تهران، ایران

2 گروه پاتوبیولوژی، دانشکده دامپزشکی دانشگاه فردوسی مشهد، مشهد، ایران

3 گروه بیماری‎‌های داخلی، دانشکده دامپزشکی دانشگاه تهران، تهران، ایران

چکیده

زمینۀ مطالعه: کنه‌ها از مهم‌ترین انگل‌های خارجی می‌باشند که باعث ایجاد زیان اقتصادی فراوانی در صنعت دامپروری می‌شوند. لذا تلاش در جهت حذف یا کاهش آن‌ها بر روی دام‌ها بسیار ضروری می‌باشد. سیستئین پروتئازها از جمله ترکیباتی هستند که نقش مهمی را در اعمال فیزیولوژیک کنه‌ها بر عهده دارند و کاندید مناسبی برای دست یابی به واکسن ضد کنه می‌باشند. کاتپسین‌ها یکی از مهم‌ترین سیستئین پروتئاز‌ها می‌باشند.
هدف: هدف از این مطالعه، کلونینگ و بیان قطعه ژنی کاتپسین L کنه ریپی‌سفالوس آنولاتوس به‌منظور بررسی ایمنوژنیسیتی آن بوده است.
روش‌کار: پس از جمع‌آوری کنه‌ها و تشخیص جنس و گونه آن‌ها اقدام به کشت کنه‌ها گردید. سپس استخراج RNA از نوزاد کنه‌ها، سنتز cDNA با استفاده از پرایمر اختصاصی کاتپسین و تکثیر آن با روش RT-PCR انجام پذیرفت. قطعه ژنی موردنظر در پلاسمید بیانی pQE30 کلون شد. در ادامه توالی کوتاه‌تری از ژن کاتپسین (654 جفت باز) نیز بصورت پلاسمید صناعی تهیه گردید. بیان پروتئین حاصل از هر دو پلاسمید نوترکیب در سیستم بیان پروکاریوتی E.ColiBL21 انجام و ایمنی‌زایی پروتئین‌های نوترکیب حاصل از آن با روش‌های سرولوژیک دات بلات و وسترن بلات در مواجهه با سرم خرگوش‌های چالش‌یافته با این پروتئین‌ها و گوساله‌های آلوده به کنه مورد بررسی و مقایسه قرار گرفت.
نتایج: نتایج مطالعه حاضر نشان داد پروتئین حاصل از پلاسمید نوترکیب صناعی به دلیل حلالیت بیشتر بیان و تخلیص بالاتری داشت. همچنین سرم خرگوش چالش‌یافته با این پروتئین‌ها، قابلیت شناسایی هر دو پروتئین نوترکیب را داشت. اما شدت واکنش سرم گوساله‌های آلوده به کنه با پروتئین‌های نوترکیب تولید شده کمتر بود.
نتیجه‌گیری نهایی: هر چند شدت واکنش سرم گوساله‌های آلوده به کنه با پروتئین‌های نوترکیب در مقایسه با سرم خرگوش کمتر بود، اما این امر با توجه به پنهان بودن آنتی‌ژن کاتپسین در روده کنه دور از ذهن نبود. در مجموع پروتئین نوترکیب کاتپسین ال می‌تواند به عنوان یک گزینه مناسب در جهت ایمن‌سازی گوساله علیه آلودگی به کنه ریپی سفالوس آنولاتوس به کار رود، هر چند بررسی‌های بیشتر در این زمینه ضروری به نظر می‌رسد.

کلیدواژه‌ها


عنوان مقاله [English]

Cloning and Expression of Gene Coding Cathepsin L of Rhipicephalus annulatus

نویسندگان [English]

  • Saeed Sattari Tabrizi 1
  • Sedigheh Nabian 1
  • Elahe Ebrahimzadeh 2
  • Parviz Shayan 1
  • Naser Alidadi 3
  • Narges Amininia 1
1 Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran
2 Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran
3 Department of Internal Medicine, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran
چکیده [English]

BACKGROUND: Ticks are one of the most important ectoparasites in animals that cause economic losses in livestock industry. So, removal or reduction of ticks on animals is necessary. Cysteine proteases are among the compounds that play an important role in the physiological action of ticks and are a good candidate for the anti-tick vaccine. Cathepsins is one of the most important cysteine proteases.
OBJECTIVES: The aim of this study was cloning and expression of recombinant cathepsin L gene of Rhipicephalus annulatus in order to evaluate its immunogenicity.
METHODS: After collection the ticks were cultivated. Then RNA was extracted from ticks, cDNA was synthesized by using specific primer of cathepsin and amplification by RT-PCR. The desired genes were cloned into expressional pQE30 plasmid. Further, a shorter sequence of the cathepsin gene (654 bp) was prepared as a synthetic plasmid. The expression of the protein produced by both recombinant plasmids in the E.coliBL21 prokaryotic expression system is carried out and the immunity of the recombinant proteins was evaluated by Dot Blot and Western Blot using serum of challenged rabbits with recombinant protein and calves infected with ticks were examined and compared.
RESULTS: The results of this study indicate that the protein derived from recombinant plasmid No. 2 had higher expression and purity due to its solubility. Also, the challenge of rabbit serum with these proteins was able to identify both recombinant proteins. But the serum of challenged calves with ticks did not show a satisfactory response with recombinant proteins.
CONCLUSIONS: Although the sera reaction of calves infested with ticks was lower than the challenged rabbits sera with cathepsin L, this result was expected, because L cathepsin protein is considered as a concealed antigen.  Overall, the recombinant cathepsin L could be an appropriate candidate for immunizing calves against Rhipicephalus annulatus, although it seems further investigations are necessary.

کلیدواژه‌ها [English]

  • Rhipicephalus annulatus
  • Tick
  • Cloning
  • gene expression
  • Cathepsin protein

مقدمه


گونه‌‌های مختلف کنه بوافیلوس از جمله بوافیلوس آنولاتوس در سال‌های اخیر تحت عنوان زیر جنس ریپی‌سفالوس نام‌گذاری گردیده‌اند (20). کنه ریپی‌سفالوس آنولاتوس یک انگل خارجی خون‌خوار می‌باشد که با فعالیت خون‌خواری خود و همچنین از طریق انتقال عوامل پاتوژن باعث کاهش شدید تولیدات در گاو و ضرر و زیان اقتصادی فراوان می‌شود (1،29). گاو میزبان انتخابی این کنه می‌باشد اما گونه‌های این کنه می‌توانند در پستانداران مختلف ازجمله انسان نیز مشاهده شوند. کنه ریپی‌سفالوس آنولاتوس مهم‌ترین ناقل بابزیا بویس و بابزیا بایژمینا در خاورمیانه می‌باشد. این‌گونه کنه همچنین می‌تواند ریکتزیاهای مختلف ازجمله آناپلاسما مارژیناله، ریکتزیا آیشلیمانی و ریکتزیا آفریکا را به گاو انتقال دهد (24). با توجه به درجات مختلف مقاومت کنه‌ها به سموم شیمیایی ضد کنه، اخیراً از سیاست‌های کنترلی مختلفی جهت مبارزه با جمعیت کنه‌ها بر روی دام‌ها استفاده شده است که ازجمله آن‌ها تولید واکسن‌های ضد کنه‌ای می‌باشد. به این منظور پروتئین‌های مختلفی ازجمله Bm86/Bm95، Ferritin 2 (Fer-2) و Subolesin (SUB) کنه‌های مختلف ازجمله گونه‌های کنه رپی‌سفالوس استفاده شده است (4،13،25).

پروتئین‌های مختلفی در فیزیولوژی و بیولوژی کنه‌ها نقش دارند. از جمله این پروتئین‌ها می‌توان به سیستئین پروتئازها اشاره نمود که نقش‌های مهمی در واکنش بین کنه و میزبان مانند هضم هموگلوبین در روده، تخریب ویتلین و انتقال پاتوژن‌ها دارند (28).

کاتپسین L که به‌عنوان پرو آنزیم ساخته می‌شود، یکی از سیستئین پروتئازهای خانواده C1 می‌باشد (کاتپسین L و کاتپسین B). این پروتئین، در بازسازی بافتی، سیستم ایمنی و همچنین در عملکرد‌های سلولی نقش دارد (7) و  فعالیت عملکردی آن در چندین گونه کنه شرح داده شده است، ازجمله این کنه‌ها ریپی‌سفالوس آنولاتوس (35)، ریپی‌سفالوس میکروپولوس (8،28) شرح داده شده است. در ریپی‌سفالوس آنولاتوس تعدادی پروتئین ایمنی‌‌زای دیگر نیز بررسی شده است که ازجمله آن‌ها می‌توان به سرین پروتئازها، ویتلوژنین و تروپومیوزین اشاره کرد (21،22،23،27،35). لذا با توجه به اهمیت سرین پروتئاز‌ها و سیستئین پروتئازها و ازجمله کاتپسین L در کنه ریپی‌سفالوس آنولاتوس، هدف از این مطالعه تولید پروتئین نوترکیب کاتپسین L و بررسی ایمنی‌زایی آن بوده است.

مواد و روش کار

جمع‌آوری و کشت کنه: در این مطالعه، تعداد 20 عدد کنه ماده بالغ خون خورده بوفیلوس آنولاتوس از روی گاوهای استان مازندران جمع‌آوری شد و پس از تشخیص جنس و گونه آن‌ها با استفاده از کلید تشخیص معتبر، کشت داده شدند. به این منظور کنه‌های بالغ خون خورده ابتدا با استفاده از الکل 70 درصد شستشو داده شده و خشک گردیدند. سپس در داخل هر لوله فالکن پنج عدد از این کنه‌ها قرار داده شد و درب فالکن‌ها با پنبه استریل پوشانیده شد و در داخل دسیکاتور در دمای 28 درجه سانتی‌گراد و رطوبت نسبی 80 درصد جهت تخم‌ریزی قرار داده شدند. پس از تخم‌ریزی، تخم‌ها در فالکن‌های مجزا جمع‌آوری شده و مطابق شرایط ذکرشده در دسیکاتور تا زمان خروج نوزاد از آن‌ها نگه‌داری شدند. نوزاد کنه‌ها 20 روز پس از خروج نوزاد از تخم‌ها، جمع‌آوری شدند.

استخراج RNA و ساخت cDNA: استخراج RNA از 2 گرم لارو 20 روزه کنه ریپی‌سفالوس آنولاتوس، با استفاده از کیت استخراج RNA (Roche, Basel, Switzerland) طبق دستورالعمل شرکت سازنده انجام شد. RNA استخراج ‌شده پس از پاک‌سازی از آلودگی احتمالی به DNA، بر روی ژل آگارز 1 درصد الکتروفورز و بررسی شد. سپس یک میکرو‌لیتر از RNA استخراج‌شده به‌منظور ساخت cDNA با استفاده از کیت ساخت cDNA (Intron Biotechnology, Kyungki-Do, Korea) استفاده شد و به آن 5/0 میکرو لیتر آنزیم AMV-RT (10 واحد در میکرولیتر)، یک میکرو لیتر پرایمر oligo (dT) (2/0 میلی مولار)، دو میکرو لیتر dNTP RNase free (10 میلی مولار)، یک میکرو لیتر ممانعت کننده RNase (10 واحد در میکرولیتر)، دو میکرو لیتر DTT (1/0 مولار) و چهار میکرو لیتر بافر RT در حجم نهایی 20 میکرو لیتر اضافه گردید. به‌منظور ساخت cDNA، این مجموعه به مدت یک ساعت در دمای 42 درجه سانتی‌گراد قرار داده شد و پس‌ازآن به مدت 5 دقیقه در دمای 70 درجه سانتی‌گراد به‌منظور توقف عملکرد آنزیم قرار گرفت.

RT-PCR: ابتدا به منظور کنترل صحت سنتز cDNA با استفاده از پرایمرهای اختصاصی ژن Cox1 کنه ریپی‌سفالوس آنولاتوس PCR انجام شد و باند مورد انتظار 500 جفت باز به دست آمد. تکثیر cDNA با استفاده از جفت پرایمر F1/R1 مستخرج از توالی نوکلئوتیدی mRNA‌ی ژن کاتپسین L کنه بوفیلوس میکروپولوس (BmCL1) (GenBank accession number AF227957.1) (جدول 1) در دستگاه ترموسایکلر (MWG Biotech, Germany) با استفاده از برنامه زیر انجام گرفت. 5 دقیقه در دمای 95 درجه سانتی‌گراد جهت جداسازی کامل دو رشته DNA، سپس در 34 سیکل به ترتیب در 94 درجه سانتی‌گراد به مدت 45 ثانیه (جهت جداسازی ثانویه DNA)، یک دقیقه در دمای 67 درجه سانتی‌گراد (جهت اتصال پرایمرها به قسمت مکمل)، 45 ثانیه در 72 درجه (جهت انجام واکنش همانندسازی) صورت پذیرفت. سپس یک سیکل به مدت 7 دقیقه در 72 درجه سانتی‌گراد (جهت همانندسازی کامل) انجام شد. محصول RT-PCR مورد انتظار با استفاده از این جفت پرایمر به اندازه 999 جفت باز بر روی ژل آگارز یک درصد مورد ارزیابی قرار گرفت.

کلونینگ در وکتور PTZ57R/T: به منظور سهولت در هضم آنزیمی دو انتهای قطعه ژن کاتپسین، محصول PCR ابتدا در وکتور غیربیانی PTZ57R/T کلون گردید. به این منظورابتدا 100 میکرو لیتر از محصول RT-PCR با استفاده از کیت تخلیص PCR (شرکت MBST، ایران) تخلیص گردید، سپس سه میکرو لیتر از محصول تخلیص شده به محلول حاوی یک میکرو لیتر پلاسمید PTZ57R/T، دو میکرو لیتر بافر لیگیشن 5X، 33/0 میکرو لیتر آنزیم T4 DNA ligase و 7/3 میکرو لیتر آب مقطر بدون نوکلئاز (حجم نهایی 10 میکرو لیتر) اضافه گردید و به مدت 15 ساعت در دمای چهار درجه سانتی‌گراد انکوبه شد. از باکتری Escherichia coli DH5-α برای تهیه سلول پذیرا استفاده شد (14). کلنی‌های باکتری که در محیط LB رشد کرده بودند با روش Colony-PCR با استفاده از پرایمرهای اختصاصی ژن کاتپسین (F1/R1) از جهت حضور پلاسمید نوترکیب در آن‌ها مورد بررسی قرار گرفتند.

آنالیز ترادف نوکلئوتیدی: پلاسمید نوترکیب با استفاده از کیت استخراج پلاسمید (شرکت MBST، ایران) طبق دستورالعمل شرکت سازنده از باکتری‌ها استخراج گردید. پلاسمیدهای استخراج‌شده پس از بررسی روی ژل آگارز یک درصد، جهت تعیین ترادف نوکلئوتیدی به شرکت تکاپوزیست ارسال گردیدند.

کلونینگ در وکتور PQE30: به‌منظور کلونینگ قطعه ژنی کاتپسین L در پلاسمید PQE30، ابتدا پلاسمید PTZ57R/T حاوی قطعه ژنی ذکرشده با استفاده از دو آنزیم محدودالاثر BamH I و Hind III برش داده شدند. بدین‌صورت که مقدار 5/1 میکرو‌لیتر از هرکدام از آنزیم‌های Hind ІІІ‌ و Bam H І، دو میکرو لیتر بافرTango  و 15 میکرو لیتر پلاسمید استخراج‌شده PTZ57R/T حاوی قطعه ژنی کاتپسین L به میکرو تیوب استریل اضافه گردید و به مدت یک‌شب در دمای 37 درجه قرار گرفت. 10 میکرو لیتر از محصول حاصل از برش آنزیم‌های محدود‌کننده بر روی ژل آگارز یک درصد مورد الکتروفورز قرار گرفت و قطعه  bp100 کاتپسین با استفاده از کیت استخراج از ژل آگارز (شرکت MBST، ایران) از آن به‌ منظور کلونینگ در پلاسمید pQE30 استخراج گردید. بدین منظور، پلاسمید pQE30 نیز با استفاده از دو آنزیم محدودالاثر و با روشی که در بالا اشاره شد برش داده شد و قطعه نهایی 999 جفت بازی کاتپسین L با استفاده از کیت rapid DNA ligation (شرکت Roche، آلمان) در داخل قسمت مولتی کلونینگ سایت پلاسمید pQE30 کلون شد. مقادیر مورداستفاده جهت کلون قطعه به داخل پلاسمید pQE30 شامل 2میکرو لیتر قطعه نهایی (ژن هدف) و پلاسمید pQE30 برش داده‌شده با آنزیم‌های Bam H І و Hind III، 1 میکرو لیتر بافر لیگیشن 5X، 5/0 میکرو لیتر آنزیم T4 DNA ligase و 5/4 میکرو لیتر آب مقطر استریل (حجم نهایی 10 میکرو لیتر) بود که این محلول به مدت 15ساعت در دمای 4 درجه سانتی‌گراد قرار داده شد. پلاسمیدهای pQE30 حاوی قطعه موردنظر به داخل باکتری پذیرا شده E. coli BL21 منتقل‌شده و با روش‌های Colony-PCR با استفاده از جفت پرایمر pQE-F/pQE-R (جدول 1)، برش آنزیمی با استفاده از آنزیم‌های Bam H І و Hind III و تعیین توالی نوکلئوتیدی مورد تأیید قرار گرفتند. این پلاسمید نوترکیب را تحت عنوان پلاسمید نوترکیب شماره 1 (pQE30-cat1) که دربرگیرنده توالی کامل ژن کدکننده کاتپسین L است و پروتئین حاصل را پروتئین کاتپسین شماره 1 (pcat1) می‌نامیم.

ساخت پلاسمید نوترکیب (pQE30-Cathepsin) توسط شرکت بیوماتیک: توالی کوتاه‌تری از ژن کاتپسین به طول 654 جفت باز که فاقد پپتید سیگنال و دربرگیرنده اپی توپ‌های آنتی‌ژنیک کاتپسین بود، توسط شرکت بیوماتیک در داخل پلاسمید pQE30 سنتز گردید. این پلاسمید نوترکیب را تحت عنوان پلاسمید نوترکیب شماره 2 (pQE30-cat2) و پروتئین حاصل را پروتئین کاتپسین شماره 2 (pcat2) می‎نامیم.

بیان پروتئین نوترکیب کاتپسین: پس از انتقال هر دو پلاسمید نوترکیب داخل باکتری پذیرا شده E. coli BL21، یک کلونی از باکتری حاوی پلاسمید نوترکیب (pQE30-cat2, pQE30-cat1) در 5 میلی‌لیتر محیط LB مایع حاوی 100 میکروگرم بر میلی لیتر آمپی‌سیلین در دمای 37 درجه سانتی‌گراد به مدت یک‌شب کشت داده شد. به عنوان کنترل باکتری فاقد پلاسمید و باکتری حاوی پلاسمید غیرنوترکیب (pQE30) به موازات نمونه‌ها کشت داده شد. روز بعد 800 میکرولیتر از آن را به 200 میلی‌لیتر محیط LB مایع حاوی آمپی‌سیلین اضافه شد و در انکوباتور در دمای 37 درجه سانتی‌گراد تحت تکان شدید قرار گرفت تا OD600آن به 5/0 تا 6/0 رسید. واضح است باکتری فاقد پلاسمید در محیط فاقد آنتی‌بیوتیک کشت داده شد. سپس بیان پروتئین نوترکیب مورد نظر با اضافه کردن IPTG در حجم نهایی 1 میلی مولار در دمای 37 درجه سانتی‌گراد تحت تکان شدید القاء شد. پس از گذشت 3 ساعت از زمان القاء به‌وسیله IPTG، در دمای 4 درجه سانتی‌گراد تحت  x g800 سانتریفوژ گردید و مایع رویی آن دور ریخته شد. به رسوب باکتری‌ها بافر لیزکننده (7M urea, 0.1M NaH2PO4, 0.01 M Tric.Cl in H2O, pH=8) اضافه گردید و به مدت 20 دقیقه تحت تکان شدید قرار داده شدند و سپس در دمای 4 درجه سانتی‌گراد با دور  x g12000 به مدت 20 دقیقه سانتریفوژ شدند و مایع رویی آن‌که حاوی پروتئین موردنظر ما بود جمع‌آوری شد. سپس پروتئین نوترکیب کاتپسین حاوی توالی 6 هیستیدینی با استفاده از ستون‌های Ni-NTA (شرکت Qiagen، آلمان) طبق دستورالعمل شرکت سازنده، استخراج گردید و درنهایت پروتئین نوترکیب تخلیص و با روش SDS-PAGE ژل 12 درصد مورد بررسی قرار گرفت (15).

ایمن‌سازی خرگوش‌ها با پروتئین نوترکیب کاتپسین: در این مطالعه از 2 خرگوش به‌عنوان گروه آزمایش و 2 خرگوش به‌عنوان گروه شاهد استفاده شد. در گروه آزمایش در هر تزریق ابتدا میزان 300 میکروگرم از پروتئین نوترکیب (pQE30-cat2, pQE30-cat1) در یک میلی­لیتر PBS  با 2/7pH:  به‌خوبی حل شد. سپس برای تزریق اول، به این محلول یک میلی­لیتر ادجوانت کامل فروند (موسسه واکسن و سرم‌سازی رازی) اضافه گردید و در دو تزریق بعدی که به فاصله دوهفته‌ای انجام می‌گرفت به محلول فوق یک میلی­لیتر ادجوانت ناقص فروند (موسسه واکسن و سرم‌سازی رازی) اضافه می‌گردید. در گروه شاهد نیز از ترکیب یک میلی­لیترPBS  با 2/7pH=  با یک میلی­لیتر ادجوانت کامل در تزریق اول و یک میلی‌لیتر ادجوانت ناقص در دو تزریق بعدی استفاده شد. تزریقات در زیرپوست ناحیه جانبی گردن انجام می‌پذیرفت. به‌منظور بررسی روند بالا رفتن تیتر آنتی­بادی، قبل از تزریق و همچنین در هفته دوم و سوم پس از تزریق، خون‌گیری از خرگوش‌های گروه شاهد و آزمایش از طریق ورید مارژینال گوش انجام شد. در ادامه پس از لخته شدن خون، نمونه‌ خون با دور x g3000 سانتریفوژ شده و سرم‌های به‌دست‌آمده تا زمان آزمایش در دمای 20- درجه سانتی‌گراد نگه‌داری شدند.

بررسی سطح آنتی‌بادی در سرم خرگوش‌های مورد مطالعه با روش Dot Blot: سطح آنتی‌بادی در سرم خرگوش‌های گروه آزمایش و شاهد قبل از تزریق و هفته دوم و سوم پس از تزریق با روش دات بلات مورد ارزیابی قرار گرفت. به‌طور خلاصه، روی قطعات بریده ‌شده کاغذ نیتروسلولز، در گوشه بالا و سمت چپ هر قطعه کاغذ یک میکرو لیتر پروتئین نوترکیب کاتپسین نقطه‌گذاری شد. همچنین آنتی­ژن نیوکاسل به‌عنوان کنترل منفی در گوشه پائین سمت راست هر قطعه کاغذ، نقطه­گذاری شد. کاغذها در دمای آزمایشگاه به مدت 10 دقیقه خشک گردیدند. سپس جهت مسدود کردن مناطق فاقد آنتی­ژن، از محلول 3 درصد پودر شیر خشک در PBST استفاده شد و کاغذها به مدت 1 ساعت در این محلول روی صفحه لرزان قرار گرفتند و سپس سه بار با محلول شستشو PBST و هر بار به مدت 5 دقیقه شستشو داده شدند و بعد از آن کاغذهای نیتروسلولز بر روی صفحه لرزان به مدت یک ساعت در مجاورت 500 میکرو لیتر از رقت­های مختلف (100/1، 200/1، 500/1، 1000/1، 2000/1) سرم خرگوش گروه شاهد و آزمایش قبل و بعد از تزریق قرار گرفتند و سپس 3 بار و هر بار به مدت 5 دقیقه با محلول شستشو PBST شستشو داده شدند. در مرحله بعد، 500 میکرولیتر از آنتی‌بادی کونژوگه Polyclonal mouse anti Rabbit Igs/HRP ( شرکت DAKO، دانمارک) با رقت 1000/1  روی هر کاغذ ریخته شد و در شرایط تاریکی به مدت 1 ساعت روی صفحه لرزان قرار داده شدند. سپس کاغذها مجدداً 3 بار و هر بار به مدت 5 دقیقه با بافر شستشو PBST شستشو داده شدند و درنهایت بلافاصله سوبسترای DAB بر روی کاغذها ریخته شد. پس از مشاهده تغییر رنگ درنتیجه واکنش بین آنتی­ژن- آنتی­بادی، در حداکثر زمان 20 دقیقه، کاغذها با آب مقطر شسته و سپس خشک شدند.

ارزیابی سرولوژیک پروتئین نوترکیب استخراج‌شده با سرم خرگوش و گوساله: به‌منظور انجام آزمایش وسترن بلات، ابتدا محلول پروتئین نوترکیب کاتپسین (pQE30-cat2, pQE30-cat1) با روش SDS-PAGE بر روی ژل آکریل آمید 12 درصد الکتروفورز شد. پس از پایان الکتروفورز، پروتئین نوترکیب و مارکر پروتئینی در داخل تانک انتقال وسترن، بر روی کاغذ نیتروسلولز منتقل شدند. انتقال در شدت‌ جریان 30 ولت به مدت 8 ساعت انجام پذیرفت. پس از انتقال، نقاط آزاد کاغذ با استفاده از محلول 3 درصد شیر خشک رقیق‌شده در 20 TBS-Tween، به مدت یک ساعت مسدود گردید. سپس کاغذ سه بار، هر بار به مدت پنج دقیقه با بافر 20 TBS-Tween شستشو داده شد. در ادامه رقت 1 به 200 ازسرم مثبت خرگوش گروه آزمایش در هفته سوم، رقیق‌شده با بافر  20 TBS-Tween تهیه و روی کاغذ ریخته شد و به مدت یک ساعت تکان داده شد. مراحل شستشو همانند قبل تکرار شد.

پس ‌از آن با استفاده از بافر 20 TBS-Tween رقت 1 به 2000 از آنتی­بادی ثانویه پلی­کلونال ضد ایمونوگلوبولین‌های خرگوشی (شرکت DAKO، دانمارک) تهیه و کاغذها به مدت یک ساعت در مجاورت آن روی صفحه لرزان قرار گرفتند. مراحل شستشو همانند قبل تکرار شد. درنهایت سوبسترای DAB مشابه روش دات بلات ساخته و بلافاصله بر روی کاغذها ریخته شد.

درصورتی‌که پروتئین با آنتی­بادی ضد پروتئین کاتپسین کنه واکنش دهد، در محل واکنش، در فاصله زمانی کوتاه، باندی قهوه‌ای ‌رنگ مشاهده می­شد. در انتها، کاغذ با آب مقطر فراوان شسته و سپس خشک گردید. جهت بررسی واکنش بین پروتئین نوترکیب و سرم گوساله، مطابق روش فوق و از رقت 1 به 200 سرم گوساله آغوز نخورده به عنوان سرم کنترل منفی و از رقت 1 به 200 گوساله‌هایی که سه هفته در معرض کنه بودند، به عنوان کنترل مثبت استفاده شد.

نتایج

کلونینگ، بیان و استخراج پروتئین نوترکیب کاتپسین: در این مطالعه به‌ منظور تولید پروتئین نوترکیب کاتپسین L کنه ریپی‌سفالوس آنولاتوس، اقدام به جمع‌آوری کنه‌های بالغ ماده شد و پس از کشت آن‌ها و تولید تخم و سپس لارو، از لاروهای تولیدشده به‌منظور استخراج RNA استفاده شد. پس از استخراج RNA با استفاده از کیت ساخت cDNA (Intron Biotechnology, Kyungki-Do, Korea)  سنتز CDNA انجام گردید. ابتدا با استفاده از پرایمرهای اختصاصی ژن Cox1 کنه رپی‌سفالوس آنولاتوس PCR انجام شد که باند مورد انتظار  bp500 به دست آمد. درنهایت با استفاده از پرایمرهای F1/R1 اختصاصی ژن کاتپسین L کنه ریپی‌سفالوس آنولاتوس، cDNA تکثیر داده شد و قطعه نهایی ژن کاتپسین با وزن ملکولی 999 جفت باز به دست آمد (تصویر 1a). در مرحله بعد این قطعه داخل پلاسمید pTZ57R/T کلون شد و این پلاسمید حاوی قطعه موردنظر به داخل باکتری E. Coli DH5ɑ منتقل شد. وارد شدن قطعه به داخل این پلاسمید با روش PCR با استفاده از جفت پرایمر F1/R1 و همچنین تعیین ترادف نوکلئوتیدی تأیید گردید. در مرحله بعد به‌منظور تولید پروتئین نوترکیب، قطعه ژن هدف در پلاسمید بیانی pQE30 کلون شد.

کلونینگ قطعه در پلاسمید pQE30 نیز با روش‌های PCR با استفاده از پرایمرهای F1/R1، برش آنزیمی با استفاده از آنزیم‌های اندونوکلئاز BamH1 و Hind 3 (تصویر 1b) و همچنین تعیین ترادف نوکلئوتیدی تأیید شد. پس از تأیید ورود مناسب قطعه به داخل پلاسمید pQE30، بیان پروتئین نوترکیب موردنظر با اضافه نمودن IPTG القاء شد و بیان پروتئین مورد نظر با استفاده از روش SDS-PAGE در ساعت‌های مختلف بعد از القاء مورد بررسی قرار گرفت. پلاسمید نوترکیب سنتز شده توسط شرکت بیوماتیک (pQE30-cat2) نیز پس از دریافت از شرکت سازنده، به روش مشابه وارد باکتری E. coli BL21 شد و بیان پروتئین نوترکیب با اضافه نمودن IPTG القاء شد و پروتئین تولید شده در ساعات مختلف بعد از القاء با روش SDS-PAGE مورد بررسی قرار گرفت. بررسی ژل اکریل آمید پس از رنگ آمیزی کوماسی بلو، در محدوده وزن ملکولی قابل انتظار افزایش در بیان پروتئین شماره 1 (به وزن 36 کیلودالتون) و 2 (به وزن 26 کیلودالتون) را تأیید کرد (تصویر­های 2،4). پس از مشاهده باند پروتئینی موردنظر، بیان پروتئین در حجم زیاد انجام شد و پروتئین موردنظر با استفاده از ستون‌های تخلیص پروتئین Ni-NTI (شرکت Roche، آلمان) تخلیص شد (تصویر­های 3،5).

بررسی سرولوژی: در مرحله بعد، ایمنی‌زایی این پروتئین‌های نوترکیب تخلیص شده کاتپسین با روش‌های دات بلات و وسترن بلات با استفاده ازسرم خرگوش‌های چالش‌یافته با این پروتئین و هم سرم گوساله‌های در معرض کنه ریپی‌سفالوس آنولاتوس بررسی شدند.

ابتدا پروتئین 36 کیلو دالتونی کاتپسین با استفاده از سرم گوساله‌هایی که به مدت سه هفته با کنه‌های ریپی‌سفالوس چالش یافته بودند با روش وسترن بلات مورد ارزیابی قرار گرفت. نتیجه این آزمایش واکنشی ضعیف با پروتئین نوترکیب کاتپسین بود (تصویر 6). اما سرم خرگوش‌های چالش یافته با این پروتئین نوترکیب کاتپسین واکنش واضحی نشان داد و باند واضحی در محدوده وزنی 36 کیلودالتون مشاهده شد (تصویر 7).

همچنین در خرگوش‌های چالش‌یافته با این پروتئین نوترکیب کاتپسین، سطح تیتر آنتی‌بادی قبل از تزریق و پس از تزریق این پروتئین در هفته‌های دوم، سوم و چهارم با روش دات بلات مورد بررسی قرار گرفت. نتایج دات بلات نشان داد که سرم خرگوش‌های چالش یافته با پروتئین مورد نظر قبل از تزریق هیچ واکنشی با آنتی‌ژن کاتپسین نشان ندادند اما سرم این خرگوش‌ها در هفته‌های دوم، سوم و چهارم با پروتئین نوترکیب کاتپسین واکنش مشخصی نشان دادند (تصویر 8).

توالی کوتاهتری از ژن کاتپسین به طول 654 جفت باز که فاقد پپتید سیگنال و دربرگیرنده اپی‌توپ‌های آنتی‌ژنیک کاتپسین بود، توسط شرکت بیوماتیک کانادا در داخل پلاسمید pQE30 سنتز گردید. نتایج حاصل از وسترن بلات پروتئین‌های بیانی حاصل از پلاسمید شماره 2 با سرم خرگوش چالش یافته با این پروتئین باندی واضح در محدوده 26 کیلودالتون ایجاد کرد (تصویر 9). اما با سرم گوساله واکنش قابل قبولی ایجاد نکرد.

بحث

کنه‌ها، ازجمله مهم‌ترین انگل‌‌های جلدی دام‌ها می‌باشند که در حین  اتصال به دام، میزان زیادی خون برحسب جنس و گونه از میزبان دریافت می‌کنند و همچنین به‌واسطه انتقال عوامل عفونی متعدد به انسان و حیوان، از جهت بهداشت عمومی نیز حائز اهمیت هستند (12). آلودگی حیوانات با کنه ریپی‌سفالوس آنولاتوس باعث ‌ایجاد خسارت‌‌های اقتصادی شدید ازجمله کاهش وزن، کاهش تولید شیر و همچنین انتقال اجرام پاتوژن ازجمله بابزیوز و آناپلاسموز می‌‌شود (16).

یکی از روش‌های اصلی جهت کنترل کنه‌ها استفاده از سموم کنه‌کش می‌باشد (11). سموم کنه‌کش دارای نقاط ضعف عمده‌ای می‌باشند که ازجمله آن‌ها می‌توان به ایجاد باقیمانده دارویی در شیر و گوشت گاو و همچنین آلودگی محیط‌زیست اشاره نمود. از طرف دیگر استفاده فراوان از این سموم می‌تواند سبب بروز مقاومت انگلی گردد (6، 5).‌ لذا به‌منظور جلوگیری از خطرات ناشی از مصرف این سموم، روش‌‌های جایگزین دیگر، از جمله کنترل بیولوژیک و واکسیناسیون جهت مبارزه با کنه‌ها بخصوص در مناطقی که مقاومت کنه‌ای بروز یافته، اتخاذ شده است (5،17،33،34،38).

ازجمله پروتئین‌هایی که به‌منظور تهیه واکسن کنه در گاو استفاده شده است می‌توان به Bm86/Bm95 اشاره نمود. آنتی‌ژن Bm86 در میدگات کنه ریپی‌سفالوس میکروپولوس قرار دارد. استفاده از این واکسن به‌طور متوسط باعث کاهش 50 درصدی میزان کنه‌های خون خورده ماده بعد از آلودگی گاو به کنه می‌شود و همچنین می‌تواند تا 90 درصد کاهش تخم‌ریزی در کنه‌های ماده خون خورده شود (4). همچنین گزارش‌شده است که میزان تأثیر این واکسن بستگی به گونه کنه و ادجوانت مورداستفاده می‌تواند بین 27 تا 65 درصد در نوسان باشد (10،25).

به‌ منظور تهیه واکسن، انتخاب آنتی‌ژن مناسب جهت تحریک سیستم ایمنی میزبان بسیار حائز اهمیت می‌باشد و لازمه آن شناخت ساختارهای ژنتیکی و پروتئینی کنه‌ها و عملکرد آن‌ها در بیولوژی و فیزیولوژی کنه‌ها می‌باشد. در مطالعات گذشته وجود پروتئازهای مختلف ازجمله کاتپسین‌ها در کنه‌های مختلف نشان داده‌شده است. بیشتر ‌این پروتئاز‌ها متعلق به فوق خانواده شبه پاپائین (papain- like) سیستئین پروتئاز‌ها هستند (9).

سیستئین پروتئاز‌ها دارای دو نقش مهم در هضم خون و امبریوژنز در چرخه زندگی کنه‌‌ها می‌باشند (3،7،8). با توجه به عملکرد ضروری سیستئین پروتئاز‌های مختلف در ارتباط با واکنش‌‌های متقابل انگل و میزبان در جهت بقاء انگل، توجه خاصی به آن‌ها به‌عنوان هدف روش‌‌های درمانی و ‌ایمونوپروفیلاکسی شده است (32، 31). در چند دهه اخیر، فعالیت‌‌های آنزیم‌‌های تخلیص شده و ژن‌‌های کد کننده سیستئین و آسپارتیک پروتئاز‌ها که هر دو در هضم خون نقش دارند در چندین گونه کنه مورد بررسی قرار گرفتند. کاتپسینL  ریپی‌سفالوس (بوافیلوس) میکروپولوس(Bm CL1) در سال 2000 مورد بررسی قرار گرفت. سپس با استفاده از روش‌‌های RT-PCR و وسترن بلات با استفاده از آنتی‌بادی‌‌ها علیه BmCL1 نوترکیب بیان‌شده در اشرشیا کلای، مشخص گردید که این آنزیم تنها در روده کنه‌، بیان می‌‌شود.‌ این پروتئین به‌عنوان یک پروتئین پیش ساز 42 کیلو دالتونی با یک دومن پپتیداز 23 کیلو دالتونی بیان می‌‌گردد (28،29). همچنین سیستئین پپتیداز‌های 40 و 48 کیلو دالتونی در کنه سخت همافیزالیس لونژیکورنیس روده تعیین شد (18). دو mRNAs کد کننده پروتئین مشابه کاتپسینL  با روش RT-PCR با استفاده از cDNA  جداشده از روده همافیزالیس لونژیکورنیس شناسایی شد (19، 18). اخیراً یک کاتپسین L مربوط به کنه همافیزالیس لونژیکورنیس به‌عنوان آنزیم نوترکیب در اشرشیا کولای‌، تهیه و عمل آن مشخص شد (39).

همچنین ‌این سیستئین پروتئازها و نقش آن در بسیاری از انگل‌‌های دیگر ازجمله ‌ترماتود‌ها، سستود‌ها، نماتود‌ها و تک‌یاخته‌ای‌ها مورد مطالعه قرار گرفته است. سیستئین پروتئاز‌های تک‌یاخته‌ای مختلف ازجمله انتاموبا هیستولیتیکا، توکسوپلاسما گوندی و پلاسمودیوم‌‌ها نیز مورد بررسی قرارگرفته و به‌عنوان انتخاب مناسبی جهت پیشگیری از عفونت‌‌های انگلی معرفی‌شده‌اند (2،26،32). تحقیقات مختلف حاکی از توانایی بالقوه بسیاری از پروتئاز‌ها ازجمله کاتپسین‌‌ها به‌عنوان کاندید واکسن و دارو در جهت کنترل آلودگی‌‌های انگلی مختلف می‌باشد.

با توجه به اهمیت این پروتئین‌ها در کنه‌ها، Nabian و Nikpay در سال 2007 الگوی پروتئینی غدد بزاقی کنه ریپی‌سفالوس آنولاتوس را شناسایی کردند و تعدادی از این پروتئین‌ها را تعیین هویت کرده و پروتئین‌های ایمنوژن را با استفاده از روش الایزا مشخص نمودند (23). پس از شناسایی پروتئین‌های ایمنوژن و تعیین سکانس آن‌ها با استفاده از اسپکتوفتومتری اقدام به تعیین حضور کاتپسین‌ها در کنه ریپی‌سفالوس آنولاتوس موجود در ایران نمودند و نقش آن را در هضم ژلاتین و هموگلوبین نشان دادند (22) و سپس ژن کد کننده پروتئین سیستئین پروتئاز شبه کاتپسین L در کنه رپی‌سفالوس آنولاتوس در ایران را شناسایی و توالی نوکلئوتیدی آن را مشخص نمودند (31). توالی حاصل برابر با 999 جفت باز بدست آمد که ‌این نتایج با نتایج بررسی  Renardو همکاران در سال 2000 که بر روی نوزاد کنه ریپی‌سفالوس (بوافیلوس) میکروپولوس انجام یافته بود، همخوانی داشته است (28).

لذا در مطالعه حاضر نیز، با توجه به اهمیت زیاد سیستئین پروتئازها در ارتباط با واکنش متقابل انگل و میزبان و در راستای مطالعات گذشته، همچنین به منظور دسترسی به پروتئین کاندید واکسن علیه آلودگی به کنه ریپی‌سفالوس (بوافیلوس) آنولاتوس توالی ژن کد کننده پروتئین سیستئین پروتئاز شبه کاتپسین L در کنه ریپی‌سفالوس آنولاتوس در پلاسمید بیانی pQE30 کلون شد. علاوه بر این توالی کوچکتری از ژن کدکننده پروتئین سیستئین پروتئاز شبه کاتپسین L که حاوی اپی‌توپ‌های آنتی ژنیک و فاقد توالی پپتید سیگنال بود به صورت کلون شده درون پلاسمید pQE-30 توسط شرکت بیوماتیک کانادا سنتز گردید. در ادامه بیان هر دو پلاسمید نوترکیب (pQE30-cat2, pQE30-cat1) مورد مقایسه قرار گرفت. مقایسه تصاویر حاصل از الکتروفورز (SDS-PAGE) دو پروتئین بیانی نوترکیب وجود باندهای پروتئینی واضح‌تر حاصل از پروتئین بیانی پلاسمید شماره 2 (pQE30-cat2) در مقایسه با پروتئین بیانی حاصل از پلاسمید شماره 1 (pQE30-cat1) بود. توضیحی که شاید بتواند این پدیده را توجیه کند این مطلب است که توالی هدف ژن کاتپسین که در پلاسمید pQE-30 کلون شد دارای توالی ابتدایی پپتید سیگنال (Signal Peptide) بود که از توالی اسید آمینه‌ای (MLRLSVLCAIVAVTVAAS) تشکیل شده و اکثراً اسید آمینه‌های هیدروفوب را شامل می‌شد. لذا وجود توالی هیدروفوبی می‌تواند موجب تجمع پروتئین یا عدم ثبات آن شود و بیان و استخراج پروتئین را با مشکل مواجه سازد (30).

در مطالعات مشابه پیشین، کاتپسین در وکتور‌های متعددی از جمله پلاسمید pMAL-p (28) بیان شده است.

در ادامه ایمنوژنیسیتی پروتئین‌های نوترکیب حاصل با روش‌های سرولوژیک دات بلات و وسترن بلات با استفاده ازسرم خرگوش‌های چالش یافته با این پروتئین و هم سرم گوساله‌های در معرض کنه ریپی‌سفالوس آنولاتوس مورد ارزیابی قرار گرفت.

 نتایج این مطالعه نشان داد که پروتئین نوترکیب کاتپسین L با سرم‌های خرگوش‌های چالش یافته با این پروتئین واکنش واضحی با استفاده از روش‌های ایمنولوژیک ذکرشده نشان می‌دهد. اما سرم گوساله‌های آلوده به کنه با پروتئین نوترکیب کاتپسین به روش وسترن بلات واکنشی در این محدوده نشان ندادند. علت عدم واکنش مناسب پروتئین کاتپسین با سرم گوساله‌هایی که مورد گزش کنه قرار گرفته‌اند، احتمالاً به دلیل پنهان بودن این پروتئین در روده کنه و عدم رویارویی سیستم ایمنی گوساله‌های در معرض با این پروتئین می‌باشد.

با توجه به نتایج بدست آمده در ‌این مطالعه، می‌توان از پروتئین نوترکیب کاتپسین به‌عنوان گزینه مناسبی در جهت ایمن سازی علیه آلودگی به کنه ریپی سفالوس آنولاتوس استفاده کرد لذا پیشنهاد می‌‌گردد که با استفاده از روش الحاق پروتئین کاتپسین با پروتئین‌های دیگر کارآمد (در معرض و پنهان) در چرخه حیاتی این کنه اقدام به تهیه پروتئین‌های نوترکیب ترکیبی جهت ارتقای بیشتر واکنش‌های ایمنی‌زایی در میزبان علیه آلودگی کنه‌ای نمود.

سپاسگزاری

این مقاله، حاصل بخشی از نتایج پایان نامه دکترای تخصصی می‌باشد و نویسندگان بر خود لازم می‌دانند تا از حمایت مالی و پژوهشی معاونت محترم پژوهشی دانشکده دامپزشکی دانشگاه تهران تشکر و قدردانی نمایند.

تعارض منافع

بین نویسندگان تعارض در منافع گزارش نشده است.

جدول 1. توالی و مشخصات پرایمرهای کاتپسینL و پلاسمیدpQE-30 .

نام پرایمر

نام ژن

ترادف نوکلئوتیدی

دمای ذوب (درجه سانتی­گراد)

F1

Cathepsin

5´ATGCTTAGATTAAGCGTACTTTG 3´

8/67

R2

Cathepsin

5´ TTAGAC GAGGGGGTAGCTGGCC 3´

8/67

pQE-F

pQE

5´GATAACAATTTCACACAGAATTC 3´

7/56

pQE-R

pQE

5´CTATCAACAGGAGTCCAACTC 3´

7/61

تصویر 1. a1: الکتروفورز محصول واکنشRT-PCR  با استفاده از پرایمرهای اختصاصی کاتپسین. 1- نشانگر bp50، 2- محصول واکنش RT-PCR  ریپی‌سفالوس آنولاتوس (bp 1000). b1: الکتروفورز برش پلاسمید نوترکیب pTZ57R/T با آنزیم‌های محدودالاثر. 1- نشانگر bp50. 2 و 4- پلاسمید pTZ57R/T بعد از برش با آنزیم‌های اندونوکلئاز.3 و 5- پلاسمید pTZ57R/T همراه ژن کدکننده پروتئین کاتپسین L.

تصویر 2. الکتروفورز پروتئین‌های حاصل از پلاسمید نوترکیب کاتپسین (pcat1) به روش SDS-PAGE قبل و بعد از القا باکتری E. coli BL21 . 1- مارکر 2- نمونه باکتری E. coli BL21 حاوی پلاسمید بدون قطعه قبل از القا. 3- نمونه باکتری E. coli BL21 حاوی پلاسمید نوترکیب قبل از القا. 4- نمونه باکتری E. coli BL21  حاوی پلاسمید نوترکیب پس از یک ساعت بیان ژنی. 5- نمونه باکتری E. coli BL21 حاوی پلاسمید نوترکیب پس از دو ساعت بیان ژنی. 6- نمونه باکتری E. coli BL21  پس از سه ساعت بیان ژنی.

تصویر 3. الکتروفورز پروتئین نوترکیب تخلیص شده (pcat1) حاصل از پلاسمید نوترکیب کاتپسین با استفاده از ستون‌هایNi-NTA Spin Kit. 1- مارکر. 2- پروتئین تخلیص شده )الوشن اول(. 3- پروتئین تخلیص شده الوشن دوم 4- لیزات باکتری بعد از عبور از ستون. 5- محتویات حاصل از شستشوی اول ستون. 6- محتویات حاصل از شستشوی دوم ستون. 7- لیزات باکتری قبل از عبور از ستون.

تصویر 4. الکتروفورز پروتئین‌های حاصل از پلاسمید نوترکیب سنتز شده کاتپسین (pcat2) به روش SDS-PAGE قبل و بعد از القا باکتری E. coli BL21. 1- نمونه باکتری E. coli BL21قبل از القاء. 2- نمونه باکتری E. coli BL21حاوی پلاسمید بدون قطعه قبل از القاء. 3- نمونه باکتری E. coli BL21 حاوی پلاسمید نوترکیب قبل از القاء. 4- نمونه باکتری E. coli BL21  حاوی پلاسمید نوترکیب پس از یک ساعت بیان ژنی. 5- نمونه باکتری E. coli BL21 حاوی پلاسمید نوترکیب پس از دو ساعت بیان ژنی. 6- نمونه باکتری E. coli BL21 پس از سه ساعت بیان ژنی. 7- نمونه باکتری E. coli BL21 حاوی پلاسمید نوترکیب پس از چهار ساعت بیان ژنی. 8- مارکر.

تصویر 5. نتایج مربوط به الکتروفورز مراحل مختلف استخراج پروتئین با استفاده از ستون­هایNi-NTA Spin Kit . 1- پروتئین تخلیص شده الوشن دوم. 2- پروتئین تخلیص شده الوشن اول. 3- محتویات حاصل از شستشوی دوم ستون. 4- محتویات حاصل از شستشوی اول ستون . 5- لیزات باکتری بعد از عبور از ستون. 6- لیزات باکتری قبل از عبور از ستون. 7- مارکر.

تصویر 6. 1،2- وسترن بلات بین پروتئین حاصل از پلاسمید نوترکیب کاتپسین با سرم گوساله آلوده به کنه. 3- مارکر.